Incidental Mutation 'R7428:Ism2'
ID576268
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Nameisthmin 2
SynonymsThsd3, LOC217738
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7428 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87278638-87299705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87286995 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 92 (T92K)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051601] [ENSMUST00000125733]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051601
AA Change: T48K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053451
Gene: ENSMUSG00000050671
AA Change: T48K

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
TSP1 206 248 3.9e-7 SMART
AMOP 273 437 1.21e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125733
AA Change: T92K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: T92K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa10 T A 8: 62,092,509 Y63F probably benign Het
Atl2 T C 17: 79,875,798 probably null Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cep295 A G 9: 15,333,498 S1221P possibly damaging Het
Cep350 T C 1: 155,894,619 S1842G probably benign Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Creb5 C A 6: 53,681,158 Q158K unknown Het
Crtam G C 9: 40,981,182 A266G probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Ddit4l A G 3: 137,626,170 E99G probably damaging Het
Dmbt1 A T 7: 131,108,463 T1495S possibly damaging Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Leng8 C T 7: 4,143,573 R395W probably damaging Het
Mocs2 A G 13: 114,820,864 I6V probably benign Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Myh13 A G 11: 67,332,564 T237A probably damaging Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup205 T A 6: 35,227,559 I1460N probably damaging Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Otof G T 5: 30,389,825 D383E probably damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pclo A T 5: 14,750,517 I1179F Het
Pde6c T C 19: 38,157,536 probably null Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Prkg1 T C 19: 30,578,835 I585M probably damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Ptprd G A 4: 76,086,468 P17S probably benign Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Sap30 C T 8: 57,487,512 V19M possibly damaging Het
Scrib G A 15: 76,061,198 T721M probably damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Slco4c1 T C 1: 96,837,520 T402A possibly damaging Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Taar8c A C 10: 24,101,548 L122R probably damaging Het
Tbc1d2 G A 4: 46,649,965 P24S probably benign Het
Tex36 T C 7: 133,595,137 probably null Het
Tmem145 T C 7: 25,307,165 probably null Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Vars2 A T 17: 35,666,686 V118E probably benign Het
Vmn1r195 T C 13: 22,278,852 V164A probably benign Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wnt9b T C 11: 103,730,817 Q338R probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Zfp541 A T 7: 16,092,868 R1181W probably damaging Het
Zfp867 C T 11: 59,463,934 G190S probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4243001:Ism2 UTSW 12 87287058 missense probably benign 0.00
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R2859:Ism2 UTSW 12 87299663 missense unknown
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R3425:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R4769:Ism2 UTSW 12 87299581 missense probably benign 0.06
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R6838:Ism2 UTSW 12 87280201 missense probably benign 0.23
R7019:Ism2 UTSW 12 87299663 missense unknown
R7358:Ism2 UTSW 12 87280040 missense probably damaging 1.00
R7427:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7777:Ism2 UTSW 12 87286884 splice site probably null
R7824:Ism2 UTSW 12 87279860 missense probably damaging 1.00
Z1177:Ism2 UTSW 12 87280035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCAGGAGTCCACTGTC -3'
(R):5'- GAAGCTGACTTTGGTCACTCC -3'

Sequencing Primer
(F):5'- AGGAGTCCACTGTCTTCACAC -3'
(R):5'- GACTTTGGTCACTCCGCTTC -3'
Posted On2019-10-07