Incidental Mutation 'R7429:Zbp1'
ID576296
Institutional Source Beutler Lab
Gene Symbol Zbp1
Ensembl Gene ENSMUSG00000027514
Gene NameZ-DNA binding protein 1
SynonymsDai, mZaDLM
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7429 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location173206612-173218923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173213818 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 184 (K184N)
Ref Sequence ENSEMBL: ENSMUSP00000104744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029018] [ENSMUST00000109116]
Predicted Effect probably benign
Transcript: ENSMUST00000029018
SMART Domains Protein: ENSMUSP00000029018
Gene: ENSMUSG00000027514

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Pfam:RHIM 163 202 1.8e-8 PFAM
Pfam:RHIM 208 258 1.2e-5 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000109116
AA Change: K184N
SMART Domains Protein: ENSMUSP00000104744
Gene: ENSMUSG00000027514
AA Change: K184N

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display normal innate immune activation by double-stranded B-form DNA (B-DNA) as well as normal adaptive immune responses to DNA vaccination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,307 C60R unknown Het
A430033K04Rik A G 5: 138,636,183 D20G possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Ankle2 C T 5: 110,234,518 T120I possibly damaging Het
Ap2b1 C T 11: 83,367,998 T765I probably benign Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
Btbd7 T C 12: 102,837,780 T334A probably damaging Het
Cdh18 T C 15: 23,366,856 V216A possibly damaging Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dido1 G A 2: 180,689,526 T43M possibly damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fam184b G A 5: 45,540,888 T655I probably benign Het
Fcgr3 A G 1: 171,057,873 M61T probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Galnt4 A G 10: 99,109,748 H445R probably damaging Het
Gm13124 T A 4: 144,565,056 I27F probably benign Het
Gm44501 A G 17: 40,576,626 T12A probably null Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hs3st4 T C 7: 124,397,382 F424L probably damaging Het
Ifi206 A T 1: 173,480,591 V613E Het
Insig1 T C 5: 28,075,079 F223S probably damaging Het
Iqgap1 C T 7: 80,751,440 E500K probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lrrfip2 T G 9: 111,185,126 probably null Het
Mark4 C A 7: 19,426,167 G723C probably damaging Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Olfr406 T A 11: 74,269,753 D121E probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Pde9a T C 17: 31,470,706 L435P probably damaging Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Rnf10 T C 5: 115,248,680 N517D probably damaging Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Scarb2 T C 5: 92,485,234 I80V probably benign Het
Serpinc1 A G 1: 160,995,441 T251A probably benign Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Sipa1l3 T C 7: 29,387,206 D653G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Snx7 T C 3: 117,837,212 N249S probably benign Het
Soat2 C A 15: 102,154,300 H124Q probably damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Taok2 T C 7: 126,870,677 Q993R possibly damaging Het
Tmem161b A G 13: 84,282,747 probably null Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
U2af1l4 A G 7: 30,563,390 E12G probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Vmn1r185 A C 7: 26,611,178 F301V probably benign Het
Zfp438 A G 18: 5,214,139 V273A probably benign Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Zbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Zbp1 APN 2 173212245 missense possibly damaging 0.95
IGL01924:Zbp1 APN 2 173212254 missense probably benign 0.09
IGL02804:Zbp1 APN 2 173209146 missense probably damaging 1.00
PIT4362001:Zbp1 UTSW 2 173216990 missense probably damaging 1.00
R2100:Zbp1 UTSW 2 173209244 missense probably damaging 1.00
R2269:Zbp1 UTSW 2 173218823 start gained probably benign
R3795:Zbp1 UTSW 2 173212179 missense probably benign 0.21
R4649:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4653:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4792:Zbp1 UTSW 2 173209213 missense probably damaging 1.00
R4807:Zbp1 UTSW 2 173212206 missense probably damaging 1.00
R5899:Zbp1 UTSW 2 173210547 missense probably benign 0.29
R6290:Zbp1 UTSW 2 173215841 missense probably damaging 1.00
R6705:Zbp1 UTSW 2 173213887 nonsense probably null
R6835:Zbp1 UTSW 2 173213911 critical splice acceptor site probably null
R7269:Zbp1 UTSW 2 173213872 missense unknown
R7337:Zbp1 UTSW 2 173218753 nonsense probably null
R7419:Zbp1 UTSW 2 173209165 missense probably benign 0.00
R7508:Zbp1 UTSW 2 173207811 missense possibly damaging 0.72
R8021:Zbp1 UTSW 2 173209210 missense possibly damaging 0.78
Z1177:Zbp1 UTSW 2 173207741 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGAAAGAAAGAACAACTACAGAAAG -3'
(R):5'- AAGCCTGAAGATGCCGAGAT -3'

Sequencing Primer
(F):5'- AGAACAACTACAGAAAGAAAGGAAAG -3'
(R):5'- TAGCAGTATCAGCTCTGAGCC -3'
Posted On2019-10-07