Incidental Mutation 'R7429:Fam184b'
ID 576306
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Name family with sequence similarity 184, member B
Synonyms 9630031F12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7429 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 45529705-45639614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45540888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 655 (T655I)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023]
AlphaFold Q0KK56
Predicted Effect probably benign
Transcript: ENSMUST00000016023
AA Change: T655I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: T655I

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,307 C60R unknown Het
A430033K04Rik A G 5: 138,636,183 D20G possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Ankle2 C T 5: 110,234,518 T120I possibly damaging Het
Ap2b1 C T 11: 83,367,998 T765I probably benign Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
Btbd7 T C 12: 102,837,780 T334A probably damaging Het
Cdh18 T C 15: 23,366,856 V216A possibly damaging Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dido1 G A 2: 180,689,526 T43M possibly damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fcgr3 A G 1: 171,057,873 M61T probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Galnt4 A G 10: 99,109,748 H445R probably damaging Het
Gm13124 T A 4: 144,565,056 I27F probably benign Het
Gm44501 A G 17: 40,576,626 T12A probably null Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hs3st4 T C 7: 124,397,382 F424L probably damaging Het
Ifi206 A T 1: 173,480,591 V613E Het
Insig1 T C 5: 28,075,079 F223S probably damaging Het
Iqgap1 C T 7: 80,751,440 E500K probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lrrfip2 T G 9: 111,185,126 probably null Het
Mark4 C A 7: 19,426,167 G723C probably damaging Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Olfr406 T A 11: 74,269,753 D121E probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Pde9a T C 17: 31,470,706 L435P probably damaging Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Rnf10 T C 5: 115,248,680 N517D probably damaging Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Scarb2 T C 5: 92,485,234 I80V probably benign Het
Serpinc1 A G 1: 160,995,441 T251A probably benign Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Sipa1l3 T C 7: 29,387,206 D653G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Snx7 T C 3: 117,837,212 N249S probably benign Het
Soat2 C A 15: 102,154,300 H124Q probably damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Taok2 T C 7: 126,870,677 Q993R possibly damaging Het
Tmem161b A G 13: 84,282,747 probably null Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
U2af1l4 A G 7: 30,563,390 E12G probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Vmn1r185 A C 7: 26,611,178 F301V probably benign Het
Zbp1 T A 2: 173,213,818 K184N unknown Het
Zfp438 A G 18: 5,214,139 V273A probably benign Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45539749 missense probably benign 0.17
IGL00781:Fam184b APN 5 45555192 splice site probably null
IGL01636:Fam184b APN 5 45584295 missense probably benign 0.00
IGL02008:Fam184b APN 5 45532823 missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45639151 missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45532815 nonsense probably null
IGL02192:Fam184b APN 5 45537720 missense probably benign 0.00
IGL02478:Fam184b APN 5 45537697 missense probably damaging 0.99
IGL03368:Fam184b APN 5 45531824 missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45555194 splice site probably benign
R0129:Fam184b UTSW 5 45532778 missense probably damaging 1.00
R0420:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R0647:Fam184b UTSW 5 45584590 missense probably benign
R1215:Fam184b UTSW 5 45584178 missense probably damaging 1.00
R1374:Fam184b UTSW 5 45555143 missense probably benign
R1466:Fam184b UTSW 5 45580509 splice site probably benign
R1773:Fam184b UTSW 5 45584334 missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45531889 missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45539764 missense probably benign 0.00
R4375:Fam184b UTSW 5 45542343 missense probably benign
R4674:Fam184b UTSW 5 45582888 nonsense probably null
R4942:Fam184b UTSW 5 45573307 missense probably damaging 0.97
R5021:Fam184b UTSW 5 45573262 missense probably benign 0.01
R5450:Fam184b UTSW 5 45539801 missense probably benign
R5731:Fam184b UTSW 5 45553129 missense probably benign 0.00
R5858:Fam184b UTSW 5 45639119 missense probably damaging 0.99
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6060:Fam184b UTSW 5 45553147 missense probably damaging 0.99
R6088:Fam184b UTSW 5 45584012 missense probably damaging 1.00
R6416:Fam184b UTSW 5 45537653 missense probably benign 0.04
R6932:Fam184b UTSW 5 45532901 splice site probably null
R6956:Fam184b UTSW 5 45530757 missense probably damaging 0.97
R6965:Fam184b UTSW 5 45555135 missense probably benign
R7229:Fam184b UTSW 5 45584175 missense probably damaging 1.00
R7303:Fam184b UTSW 5 45542226 critical splice donor site probably null
R7522:Fam184b UTSW 5 45530751 missense probably damaging 1.00
R7541:Fam184b UTSW 5 45542232 missense probably damaging 0.99
R7942:Fam184b UTSW 5 45584253 missense probably benign 0.16
R8172:Fam184b UTSW 5 45584367 missense possibly damaging 0.86
R9470:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R9649:Fam184b UTSW 5 45639142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGGTCTTGCTCTTTCC -3'
(R):5'- GAGCATACAAACATCTGGTTTCAG -3'

Sequencing Primer
(F):5'- TCCAGCTAGGGAGGGATCTATCTC -3'
(R):5'- AGGATTTACTGAATGCCCCTTAC -3'
Posted On 2019-10-07