Mutagenetix > Incidental Mutation

Incidental Mutation 'R7429:Mast3'

576322

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7429 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 70780303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 1122 (C1122G)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: C1138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: C1138G

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: C1122G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

Meta Mutation Damage Score

0.0739

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

100% (71/71)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	C	1: 85,931,307	C60R	unknown	Het
A430033K04Rik	A	G	5: 138,636,183	D20G	possibly damaging	Het
Abca9	CA	C	11: 110,127,426		probably null	Het
Ankle2	C	T	5: 110,234,518	T120I	possibly damaging	Het
Ap2b1	C	T	11: 83,367,998	T765I	probably benign	Het
Atp8b4	A	T	2: 126,403,371	V286E	possibly damaging	Het
Brms1l	T	C	12: 55,845,299	L126P	probably damaging	Het
Btbd7	T	C	12: 102,837,780	T334A	probably damaging	Het
Cdh18	T	C	15: 23,366,856	V216A	possibly damaging	Het
Chka	A	G	19: 3,892,787	Y415C	probably damaging	Het
Cnih1	C	T	14: 46,780,222	V52I	possibly damaging	Het
Cox4i1	T	A	8: 120,674,031	M145K	probably damaging	Het
Cubn	G	T	2: 13,322,993	R2674S	possibly damaging	Het
Cyfip1	A	G	7: 55,900,593	E692G	probably damaging	Het
Dido1	G	A	2: 180,689,526	T43M	possibly damaging	Het
Edc4	T	C	8: 105,891,584	S1245P	probably damaging	Het
Enpp1	G	T	10: 24,711,950	H14Q	probably benign	Het
Etaa1	C	T	11: 17,940,281	R860Q	probably damaging	Het
Fam181b	G	A	7: 93,080,195	V59M	probably benign	Het
Fam184b	G	A	5: 45,540,888	T655I	probably benign	Het
Fcgr3	A	G	1: 171,057,873	M61T	probably benign	Het
Fign	T	C	2: 63,979,060	D622G	probably damaging	Het
Frmd3	A	G	4: 74,145,105	D223G	probably damaging	Het
Galnt4	A	G	10: 99,109,748	H445R	probably damaging	Het
Gm13124	T	A	4: 144,565,056	I27F	probably benign	Het
Gm44501	A	G	17: 40,576,626	T12A	probably null	Het
Hnrnpll	T	A	17: 80,049,847	I247F	probably damaging	Het
Hs3st4	T	C	7: 124,397,382	F424L	probably damaging	Het
Ifi206	A	T	1: 173,480,591	V613E		Het
Insig1	T	C	5: 28,075,079	F223S	probably damaging	Het
Iqgap1	C	T	7: 80,751,440	E500K	probably benign	Het
Itgav	G	A	2: 83,794,258	V731M	probably damaging	Het
Lrrfip2	T	G	9: 111,185,126		probably null	Het
Mark4	C	A	7: 19,426,167	G723C	probably damaging	Het
Marveld3	A	G	8: 109,948,468	S239P	possibly damaging	Het
Ms4a4d	A	G	19: 11,557,933	I198M	probably benign	Het
Mup14	C	T	4: 61,303,448	G35E	probably damaging	Het
Myo1a	T	A	10: 127,706,847	V118E	probably damaging	Het
Nfatc3	A	G	8: 106,108,403	T794A	probably benign	Het
Olfr406	T	A	11: 74,269,753	D121E	probably damaging	Het
Olfr577	A	T	7: 102,973,762	S77T	probably damaging	Het
Olfr828	T	C	9: 18,815,354	*313W	probably null	Het
Pde6c	T	A	19: 38,141,439	Y266N	probably damaging	Het
Pde9a	T	C	17: 31,470,706	L435P	probably damaging	Het
Pgm2	T	A	4: 99,955,995	M1K	probably null	Het
Plcb4	T	C	2: 135,968,322	Y626H	probably damaging	Het
Rnf10	T	C	5: 115,248,680	N517D	probably damaging	Het
Rpap3	A	T	15: 97,688,150	L320Q	possibly damaging	Het
Rptor	T	C	11: 119,846,828	W576R	probably damaging	Het
Scarb2	T	C	5: 92,485,234	I80V	probably benign	Het
Serpinc1	A	G	1: 160,995,441	T251A	probably benign	Het
Sgk3	A	G	1: 9,872,258	D85G	probably benign	Het
Sipa1l3	T	C	7: 29,387,206	D653G	probably benign	Het
Slc2a1	A	G	4: 119,136,313	Y449C	probably damaging	Het
Snx13	T	C	12: 35,133,358	V760A	possibly damaging	Het
Snx7	T	C	3: 117,837,212	N249S	probably benign	Het
Soat2	C	A	15: 102,154,300	H124Q	probably damaging	Het
Sugt1	T	A	14: 79,619,801		probably null	Het
Syne2	C	T	12: 75,933,996	T1509M	probably damaging	Het
Syne2	T	A	12: 76,040,410	L214*	probably null	Het
Taok2	T	C	7: 126,870,677	Q993R	possibly damaging	Het
Tmem161b	A	G	13: 84,282,747		probably null	Het
Tspan17	G	A	13: 54,795,972	E213K	probably benign	Het
Ttc6	T	A	12: 57,658,102	I631N	probably benign	Het
Ttn	T	A	2: 76,810,939	L13574F	probably damaging	Het
U2af1l4	A	G	7: 30,563,390	E12G	probably benign	Het
Usp39	T	C	6: 72,342,917	Y106C	probably damaging	Het
Vmn1r185	A	C	7: 26,611,178	F301V	probably benign	Het
Zbp1	T	A	2: 173,213,818	K184N	unknown	Het
Zfp438	A	G	18: 5,214,139	V273A	probably benign	Het
Zswim5	A	G	4: 116,975,857	T596A	possibly damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTCAAAGCCAGGCCTCACTG -3'
(R):5'- GTTACCATGTCTGTCCCCAG -3'

Sequencing Primer
(F):5'- AGTCTGACCCTTAAATAATGAACAC -3'
(R):5'- TCTGTCCCCAGGCGGAAG -3'

Posted On

2019-10-07