Incidental Mutation 'R7429:Mast3'
ID 576322
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 045507-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7429 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 71232947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 1122 (C1122G)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: C1138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: C1138G

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: C1122G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (71/71)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,859,028 (GRCm39) C60R unknown Het
A430033K04Rik A G 5: 138,634,445 (GRCm39) D20G possibly damaging Het
Aadacl4fm2 T A 4: 144,291,626 (GRCm39) I27F probably benign Het
Abca9 CA C 11: 110,018,252 (GRCm39) probably null Het
Ankle2 C T 5: 110,382,384 (GRCm39) T120I possibly damaging Het
Ap2b1 C T 11: 83,258,824 (GRCm39) T765I probably benign Het
Atp8b4 A T 2: 126,245,291 (GRCm39) V286E possibly damaging Het
Brms1l T C 12: 55,892,084 (GRCm39) L126P probably damaging Het
Btbd7 T C 12: 102,804,039 (GRCm39) T334A probably damaging Het
Cdh18 T C 15: 23,366,942 (GRCm39) V216A possibly damaging Het
Chka A G 19: 3,942,787 (GRCm39) Y415C probably damaging Het
Cnih1 C T 14: 47,017,679 (GRCm39) V52I possibly damaging Het
Cox4i1 T A 8: 121,400,770 (GRCm39) M145K probably damaging Het
Cubn G T 2: 13,327,804 (GRCm39) R2674S possibly damaging Het
Cyfip1 A G 7: 55,550,341 (GRCm39) E692G probably damaging Het
Dido1 G A 2: 180,331,319 (GRCm39) T43M possibly damaging Het
Edc4 T C 8: 106,618,216 (GRCm39) S1245P probably damaging Het
Enpp1 G T 10: 24,587,848 (GRCm39) H14Q probably benign Het
Etaa1 C T 11: 17,890,281 (GRCm39) R860Q probably damaging Het
Fam181b G A 7: 92,729,403 (GRCm39) V59M probably benign Het
Fam184b G A 5: 45,698,230 (GRCm39) T655I probably benign Het
Fcgr3 A G 1: 170,885,442 (GRCm39) M61T probably benign Het
Fign T C 2: 63,809,404 (GRCm39) D622G probably damaging Het
Frmd3 A G 4: 74,063,342 (GRCm39) D223G probably damaging Het
Galnt4 A G 10: 98,945,610 (GRCm39) H445R probably damaging Het
Gm44501 A G 17: 40,887,517 (GRCm39) T12A probably null Het
Hnrnpll T A 17: 80,357,276 (GRCm39) I247F probably damaging Het
Hs3st4 T C 7: 123,996,605 (GRCm39) F424L probably damaging Het
Ifi206 A T 1: 173,308,157 (GRCm39) V613E Het
Insig1 T C 5: 28,280,077 (GRCm39) F223S probably damaging Het
Iqgap1 C T 7: 80,401,188 (GRCm39) E500K probably benign Het
Itgav G A 2: 83,624,602 (GRCm39) V731M probably damaging Het
Lrrfip2 T G 9: 111,014,194 (GRCm39) probably null Het
Mark4 C A 7: 19,160,092 (GRCm39) G723C probably damaging Het
Marveld3 A G 8: 110,675,100 (GRCm39) S239P possibly damaging Het
Ms4a4d A G 19: 11,535,297 (GRCm39) I198M probably benign Het
Mup14 C T 4: 61,259,447 (GRCm39) G35E probably damaging Het
Myo1a T A 10: 127,542,716 (GRCm39) V118E probably damaging Het
Nfatc3 A G 8: 106,835,035 (GRCm39) T794A probably benign Het
Or1p1c T A 11: 74,160,579 (GRCm39) D121E probably damaging Het
Or51g2 A T 7: 102,622,969 (GRCm39) S77T probably damaging Het
Or7g16 T C 9: 18,726,650 (GRCm39) *313W probably null Het
Pde6c T A 19: 38,129,887 (GRCm39) Y266N probably damaging Het
Pde9a T C 17: 31,689,680 (GRCm39) L435P probably damaging Het
Pgm1 T A 4: 99,813,192 (GRCm39) M1K probably null Het
Plcb4 T C 2: 135,810,242 (GRCm39) Y626H probably damaging Het
Rnf10 T C 5: 115,386,739 (GRCm39) N517D probably damaging Het
Rpap3 A T 15: 97,586,031 (GRCm39) L320Q possibly damaging Het
Rptor T C 11: 119,737,654 (GRCm39) W576R probably damaging Het
Scarb2 T C 5: 92,633,093 (GRCm39) I80V probably benign Het
Serpinc1 A G 1: 160,823,011 (GRCm39) T251A probably benign Het
Sgk3 A G 1: 9,942,483 (GRCm39) D85G probably benign Het
Sipa1l3 T C 7: 29,086,631 (GRCm39) D653G probably benign Het
Slc2a1 A G 4: 118,993,510 (GRCm39) Y449C probably damaging Het
Snx13 T C 12: 35,183,357 (GRCm39) V760A possibly damaging Het
Snx7 T C 3: 117,630,861 (GRCm39) N249S probably benign Het
Soat2 C A 15: 102,062,735 (GRCm39) H124Q probably damaging Het
Sugt1 T A 14: 79,857,241 (GRCm39) probably null Het
Syne2 C T 12: 75,980,770 (GRCm39) T1509M probably damaging Het
Syne2 T A 12: 76,087,184 (GRCm39) L214* probably null Het
Taok2 T C 7: 126,469,849 (GRCm39) Q993R possibly damaging Het
Tmem161b A G 13: 84,430,866 (GRCm39) probably null Het
Tspan17 G A 13: 54,943,785 (GRCm39) E213K probably benign Het
Ttc6 T A 12: 57,704,888 (GRCm39) I631N probably benign Het
Ttn T A 2: 76,641,283 (GRCm39) L13574F probably damaging Het
U2af1l4 A G 7: 30,262,815 (GRCm39) E12G probably benign Het
Usp39 T C 6: 72,319,900 (GRCm39) Y106C probably damaging Het
Vmn1r185 A C 7: 26,310,603 (GRCm39) F301V probably benign Het
Zbp1 T A 2: 173,055,611 (GRCm39) K184N unknown Het
Zfp438 A G 18: 5,214,139 (GRCm39) V273A probably benign Het
Zswim5 A G 4: 116,833,054 (GRCm39) T596A possibly damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAAAGCCAGGCCTCACTG -3'
(R):5'- GTTACCATGTCTGTCCCCAG -3'

Sequencing Primer
(F):5'- AGTCTGACCCTTAAATAATGAACAC -3'
(R):5'- TCTGTCCCCAGGCGGAAG -3'
Posted On 2019-10-07