Incidental Mutation 'R7429:Nfatc3'
ID576324
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
SynonymsNFATx, NFAT4, D8Ertd281e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7429 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106058840-106130537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106108403 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 794 (T794A)
Ref Sequence ENSEMBL: ENSMUSP00000104931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
Predicted Effect probably benign
Transcript: ENSMUST00000109308
AA Change: T794A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: T794A

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211991
AA Change: T786A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000212742
AA Change: T786A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,307 C60R unknown Het
A430033K04Rik A G 5: 138,636,183 D20G possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Ankle2 C T 5: 110,234,518 T120I possibly damaging Het
Ap2b1 C T 11: 83,367,998 T765I probably benign Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
Btbd7 T C 12: 102,837,780 T334A probably damaging Het
Cdh18 T C 15: 23,366,856 V216A possibly damaging Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dido1 G A 2: 180,689,526 T43M possibly damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fam184b G A 5: 45,540,888 T655I probably benign Het
Fcgr3 A G 1: 171,057,873 M61T probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Galnt4 A G 10: 99,109,748 H445R probably damaging Het
Gm13124 T A 4: 144,565,056 I27F probably benign Het
Gm44501 A G 17: 40,576,626 T12A probably null Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hs3st4 T C 7: 124,397,382 F424L probably damaging Het
Ifi206 A T 1: 173,480,591 V613E Het
Insig1 T C 5: 28,075,079 F223S probably damaging Het
Iqgap1 C T 7: 80,751,440 E500K probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lrrfip2 T G 9: 111,185,126 probably null Het
Mark4 C A 7: 19,426,167 G723C probably damaging Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Olfr406 T A 11: 74,269,753 D121E probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Pde9a T C 17: 31,470,706 L435P probably damaging Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Rnf10 T C 5: 115,248,680 N517D probably damaging Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Scarb2 T C 5: 92,485,234 I80V probably benign Het
Serpinc1 A G 1: 160,995,441 T251A probably benign Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Sipa1l3 T C 7: 29,387,206 D653G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Snx7 T C 3: 117,837,212 N249S probably benign Het
Soat2 C A 15: 102,154,300 H124Q probably damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Taok2 T C 7: 126,870,677 Q993R possibly damaging Het
Tmem161b A G 13: 84,282,747 probably null Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
U2af1l4 A G 7: 30,563,390 E12G probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Vmn1r185 A C 7: 26,611,178 F301V probably benign Het
Zbp1 T A 2: 173,213,818 K184N unknown Het
Zfp438 A G 18: 5,214,139 V273A probably benign Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106099177 missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106127921 missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106078900 missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106108185 missense probably benign 0.29
Struggles UTSW 8 106083870 nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106059973 missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106079203 missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106127942 missense possibly damaging 0.90
R0348:Nfatc3 UTSW 8 106092195 missense probably damaging 1.00
R0410:Nfatc3 UTSW 8 106096196 missense probably damaging 1.00
R1509:Nfatc3 UTSW 8 106083854 missense possibly damaging 0.46
R1702:Nfatc3 UTSW 8 106092160 missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106083834 missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106078850 missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106099136 missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106108455 missense probably damaging 1.00
R2878:Nfatc3 UTSW 8 106092144 missense probably damaging 1.00
R3802:Nfatc3 UTSW 8 106079645 missense probably damaging 0.99
R3959:Nfatc3 UTSW 8 106099077 nonsense probably null
R4006:Nfatc3 UTSW 8 106108839 missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106079491 missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106079073 missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106108379 missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106079727 missense probably damaging 1.00
R5042:Nfatc3 UTSW 8 106108125 missense probably benign 0.25
R5632:Nfatc3 UTSW 8 106079057 missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106079066 missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106096312 missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106083870 nonsense probably null
R6557:Nfatc3 UTSW 8 106119354 missense probably benign 0.01
R6737:Nfatc3 UTSW 8 106083969 missense probably damaging 1.00
R6925:Nfatc3 UTSW 8 106119322 missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106108946 missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7526:Nfatc3 UTSW 8 106079083 missense probably damaging 1.00
R7760:Nfatc3 UTSW 8 106108341 missense possibly damaging 0.66
X0063:Nfatc3 UTSW 8 106083939 missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106108349 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACACAGATTTGCCTTCAGTTCC -3'
(R):5'- GACAGTGGTTGACAGCCAAG -3'

Sequencing Primer
(F):5'- TCCTCAGAGACAGGGCAC -3'
(R):5'- CAGTGGTTGACAGCCAAGATTTAC -3'
Posted On2019-10-07