Incidental Mutation 'R7429:Marveld3'
ID576325
Institutional Source Beutler Lab
Gene Symbol Marveld3
Ensembl Gene ENSMUSG00000001672
Gene NameMARVEL (membrane-associating) domain containing 3
Synonyms1810006A16Rik, MARVD3, Mrvldc3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7429 (G1)
Quality Score204.009
Status Validated
Chromosome8
Chromosomal Location109947914-109962203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109948468 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 239 (S239P)
Ref Sequence ENSEMBL: ENSMUSP00000001722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001722] [ENSMUST00000034175] [ENSMUST00000051430] [ENSMUST00000179721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001722
AA Change: S239P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001722
Gene: ENSMUSG00000001672
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034175
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051430
SMART Domains Protein: ENSMUSP00000052309
Gene: ENSMUSG00000001672

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
Pfam:MARVEL 168 355 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179721
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,307 C60R unknown Het
A430033K04Rik A G 5: 138,636,183 D20G possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Ankle2 C T 5: 110,234,518 T120I possibly damaging Het
Ap2b1 C T 11: 83,367,998 T765I probably benign Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
Btbd7 T C 12: 102,837,780 T334A probably damaging Het
Cdh18 T C 15: 23,366,856 V216A possibly damaging Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dido1 G A 2: 180,689,526 T43M possibly damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fam184b G A 5: 45,540,888 T655I probably benign Het
Fcgr3 A G 1: 171,057,873 M61T probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Galnt4 A G 10: 99,109,748 H445R probably damaging Het
Gm13124 T A 4: 144,565,056 I27F probably benign Het
Gm44501 A G 17: 40,576,626 T12A probably null Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hs3st4 T C 7: 124,397,382 F424L probably damaging Het
Ifi206 A T 1: 173,480,591 V613E Het
Insig1 T C 5: 28,075,079 F223S probably damaging Het
Iqgap1 C T 7: 80,751,440 E500K probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lrrfip2 T G 9: 111,185,126 probably null Het
Mark4 C A 7: 19,426,167 G723C probably damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Olfr406 T A 11: 74,269,753 D121E probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Pde9a T C 17: 31,470,706 L435P probably damaging Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Rnf10 T C 5: 115,248,680 N517D probably damaging Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Scarb2 T C 5: 92,485,234 I80V probably benign Het
Serpinc1 A G 1: 160,995,441 T251A probably benign Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Sipa1l3 T C 7: 29,387,206 D653G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Snx7 T C 3: 117,837,212 N249S probably benign Het
Soat2 C A 15: 102,154,300 H124Q probably damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Taok2 T C 7: 126,870,677 Q993R possibly damaging Het
Tmem161b A G 13: 84,282,747 probably null Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
U2af1l4 A G 7: 30,563,390 E12G probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Vmn1r185 A C 7: 26,611,178 F301V probably benign Het
Zbp1 T A 2: 173,213,818 K184N unknown Het
Zfp438 A G 18: 5,214,139 V273A probably benign Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Marveld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Marveld3 APN 8 109961964 missense possibly damaging 0.81
IGL01341:Marveld3 APN 8 109948417 missense possibly damaging 0.94
IGL01415:Marveld3 APN 8 109962073 missense possibly damaging 0.92
IGL01759:Marveld3 APN 8 109948087 missense possibly damaging 0.90
IGL02012:Marveld3 APN 8 109948132 missense probably damaging 0.99
R0732:Marveld3 UTSW 8 109948483 missense probably damaging 0.99
R1500:Marveld3 UTSW 8 109948542 splice site probably null
R1955:Marveld3 UTSW 8 109959748 missense probably benign 0.08
R2146:Marveld3 UTSW 8 109959802 missense probably benign 0.00
R2172:Marveld3 UTSW 8 109961846 missense probably benign 0.22
R4843:Marveld3 UTSW 8 109962070 missense possibly damaging 0.66
R4925:Marveld3 UTSW 8 109948311 missense probably benign 0.00
R5542:Marveld3 UTSW 8 109948617 missense probably benign 0.03
R6003:Marveld3 UTSW 8 109954328 missense probably damaging 1.00
R6733:Marveld3 UTSW 8 109962049 missense possibly damaging 0.90
R6786:Marveld3 UTSW 8 109948100 missense probably benign 0.13
R7156:Marveld3 UTSW 8 109948188 missense probably damaging 1.00
R7194:Marveld3 UTSW 8 109959845 splice site probably null
R7430:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7810:Marveld3 UTSW 8 109954634 missense probably damaging 0.99
R8421:Marveld3 UTSW 8 109948647 missense probably benign 0.07
R8460:Marveld3 UTSW 8 109954408 missense probably benign 0.16
Z1088:Marveld3 UTSW 8 109948063 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGGTGGAATTGATGCGCAAC -3'
(R):5'- CCTAGGTGTGGTGCAGATAATG -3'

Sequencing Primer
(F):5'- CCGCATACAGGTAAAAGCCAATGG -3'
(R):5'- AGATAATGGAGGTGATTTTGAATGCC -3'
Posted On2019-10-07