Incidental Mutation 'R7429:Rpap3'
ID576347
Institutional Source Beutler Lab
Gene Symbol Rpap3
Ensembl Gene ENSMUSG00000022466
Gene NameRNA polymerase II associated protein 3
Synonyms2310042P20Rik, D15Ertd682e
MMRRC Submission
Accession Numbers

Genbank: NM_028003; MGI: 1277218

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7429 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location97675097-97705825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97688150 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 320 (L320Q)
Ref Sequence ENSEMBL: ENSMUSP00000023104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023104
AA Change: L320Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023104
Gene: ENSMUSG00000022466
AA Change: L320Q

DomainStartEndE-ValueType
coiled coil region 9 45 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
TPR 134 167 1.12e-7 SMART
TPR 168 201 2.07e1 SMART
TPR 202 235 2.36e-6 SMART
low complexity region 252 273 N/A INTRINSIC
TPR 284 317 6.58e-5 SMART
TPR 318 351 4.45e-2 SMART
TPR 352 385 3.87e-2 SMART
Pfam:RPAP3_C 540 631 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(10) : Targeted, other(1) Gene trapped(9)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,307 C60R unknown Het
A430033K04Rik A G 5: 138,636,183 D20G possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Ankle2 C T 5: 110,234,518 T120I possibly damaging Het
Ap2b1 C T 11: 83,367,998 T765I probably benign Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
Btbd7 T C 12: 102,837,780 T334A probably damaging Het
Cdh18 T C 15: 23,366,856 V216A possibly damaging Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dido1 G A 2: 180,689,526 T43M possibly damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fam184b G A 5: 45,540,888 T655I probably benign Het
Fcgr3 A G 1: 171,057,873 M61T probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Galnt4 A G 10: 99,109,748 H445R probably damaging Het
Gm13124 T A 4: 144,565,056 I27F probably benign Het
Gm44501 A G 17: 40,576,626 T12A probably null Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hs3st4 T C 7: 124,397,382 F424L probably damaging Het
Ifi206 A T 1: 173,480,591 V613E Het
Insig1 T C 5: 28,075,079 F223S probably damaging Het
Iqgap1 C T 7: 80,751,440 E500K probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lrrfip2 T G 9: 111,185,126 probably null Het
Mark4 C A 7: 19,426,167 G723C probably damaging Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Olfr406 T A 11: 74,269,753 D121E probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Pde9a T C 17: 31,470,706 L435P probably damaging Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Rnf10 T C 5: 115,248,680 N517D probably damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Scarb2 T C 5: 92,485,234 I80V probably benign Het
Serpinc1 A G 1: 160,995,441 T251A probably benign Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Sipa1l3 T C 7: 29,387,206 D653G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Snx7 T C 3: 117,837,212 N249S probably benign Het
Soat2 C A 15: 102,154,300 H124Q probably damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Taok2 T C 7: 126,870,677 Q993R possibly damaging Het
Tmem161b A G 13: 84,282,747 probably null Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
U2af1l4 A G 7: 30,563,390 E12G probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Vmn1r185 A C 7: 26,611,178 F301V probably benign Het
Zbp1 T A 2: 173,213,818 K184N unknown Het
Zfp438 A G 18: 5,214,139 V273A probably benign Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Rpap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Rpap3 APN 15 97703239 missense possibly damaging 0.85
IGL02714:Rpap3 APN 15 97696577 missense possibly damaging 0.93
IGL03409:Rpap3 APN 15 97681739 missense possibly damaging 0.46
R0095:Rpap3 UTSW 15 97680536 splice site probably benign
R0847:Rpap3 UTSW 15 97703201 critical splice donor site probably null
R1496:Rpap3 UTSW 15 97686483 missense possibly damaging 0.86
R1562:Rpap3 UTSW 15 97694217 missense possibly damaging 0.86
R1603:Rpap3 UTSW 15 97701121 missense possibly damaging 0.53
R1801:Rpap3 UTSW 15 97694209 missense possibly damaging 0.73
R2163:Rpap3 UTSW 15 97680348 missense possibly damaging 0.71
R4969:Rpap3 UTSW 15 97686526 missense probably benign
R5226:Rpap3 UTSW 15 97703223 missense possibly damaging 0.53
R6610:Rpap3 UTSW 15 97688168 missense probably benign 0.24
R6613:Rpap3 UTSW 15 97681841 critical splice acceptor site probably null
R7040:Rpap3 UTSW 15 97679112 missense possibly damaging 0.51
R7430:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7829:Rpap3 UTSW 15 97681708 missense probably benign 0.02
R7853:Rpap3 UTSW 15 97678418 missense possibly damaging 0.92
R8223:Rpap3 UTSW 15 97691304 missense probably benign 0.02
R8366:Rpap3 UTSW 15 97681667 missense probably benign 0.18
YA93:Rpap3 UTSW 15 97693233 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTCTAACCTAGCACTGCTGC -3'
(R):5'- CTCTAGACTCCATTAGGGCGAG -3'

Sequencing Primer
(F):5'- CCTAGCACTGCTGCAAAAATAG -3'
(R):5'- CTCCATTAGGGCGAGAACATAG -3'
Posted On2019-10-07