Incidental Mutation 'R7430:Plcb4'
ID576365
Institutional Source Beutler Lab
Gene Symbol Plcb4
Ensembl Gene ENSMUSG00000039943
Gene Namephospholipase C, beta 4
SynonymsA930039J07Rik, C230058B11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7430 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location135659011-136014593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135968322 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 626 (Y626H)
Ref Sequence ENSEMBL: ENSMUSP00000117638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000134310] [ENSMUST00000184371]
Predicted Effect probably damaging
Transcript: ENSMUST00000035646
AA Change: Y614H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: Y614H

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 1.1e-26 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110109
AA Change: Y614H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: Y614H

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 6.1e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 913 955 1.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134310
AA Change: Y626H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117638
Gene: ENSMUSG00000039943
AA Change: Y626H

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 2.5e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 577 693 2.9e-75 SMART
C2 714 813 1.6e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184371
AA Change: Y614H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943
AA Change: Y614H

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 9e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G C 17: 24,364,958 probably null Het
Ankrd17 C G 5: 90,295,657 E384Q possibly damaging Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
C2cd4d G A 3: 94,364,350 V308M possibly damaging Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Card6 G T 15: 5,099,200 Q905K probably benign Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dnah8 T C 17: 30,706,389 F1266S probably damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fat4 T A 3: 38,887,450 I164N probably damaging Het
Fat4 A G 3: 39,009,644 D4583G probably damaging Het
Fgb C T 3: 83,046,707 V75I probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Gclm G A 3: 122,246,080 R32Q probably benign Het
Grsf1 A T 5: 88,663,227 I428N possibly damaging Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hscb T A 5: 110,829,158 I223L probably benign Het
Ifi204 C T 1: 173,755,681 A324T probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lor C T 3: 92,081,899 G27S unknown Het
Lpin3 A G 2: 160,898,666 D377G probably benign Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myh1 C T 11: 67,205,567 Q291* probably null Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Nkx6-2 T C 7: 139,582,000 T154A probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Ovgp1 G C 3: 105,986,302 A464P probably damaging Het
Ovgp1 C T 3: 105,986,303 A464V possibly damaging Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Per2 C A 1: 91,423,983 E934* probably null Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Pifo T C 3: 106,014,518 R30G probably benign Het
Postn T A 3: 54,370,202 V206D probably damaging Het
Prss29 T A 17: 25,321,139 probably null Het
Ptges3l C A 11: 101,423,815 V85L possibly damaging Het
Riok2 T C 17: 17,387,540 L450S probably benign Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Slco1a5 A T 6: 142,248,712 S402T probably benign Het
Smad2 T A 18: 76,288,080 V160E probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Tmem120a T A 5: 135,736,136 probably null Het
Tmem161b A G 13: 84,282,747 probably null Het
Trim33 T C 3: 103,310,903 I256T possibly damaging Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
Tufm A G 7: 126,489,127 D228G probably benign Het
Usf1 T A 1: 171,417,727 S236T probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Usp46 T A 5: 74,003,188 Y296F probably damaging Het
Vmn2r82 A G 10: 79,381,253 N473S probably damaging Het
Washc5 A T 15: 59,369,913 Y51* probably null Het
Zfp651 G A 9: 121,763,666 D351N probably benign Het
Zfp763 T A 17: 33,019,532 Y213F possibly damaging Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Plcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Plcb4 APN 2 135971798 missense probably benign 0.26
IGL01405:Plcb4 APN 2 135950347 missense probably damaging 1.00
IGL01522:Plcb4 APN 2 136002627 missense probably damaging 1.00
IGL01589:Plcb4 APN 2 135967118 missense probably benign
IGL02090:Plcb4 APN 2 135947121 missense probably benign 0.00
IGL02247:Plcb4 APN 2 135994325 missense possibly damaging 0.95
IGL02259:Plcb4 APN 2 135910246 critical splice donor site probably null
IGL02338:Plcb4 APN 2 136000180 missense possibly damaging 0.87
IGL02625:Plcb4 APN 2 135961794 missense probably benign 0.19
IGL03026:Plcb4 APN 2 135950429 splice site probably benign
IGL03111:Plcb4 APN 2 135976282 missense probably damaging 1.00
R0044:Plcb4 UTSW 2 135971856 missense probably damaging 1.00
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0143:Plcb4 UTSW 2 135976211 missense probably damaging 1.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0348:Plcb4 UTSW 2 135968419 missense probably damaging 1.00
R0557:Plcb4 UTSW 2 135954349 missense probably damaging 0.99
R0591:Plcb4 UTSW 2 135955012 splice site probably benign
R0975:Plcb4 UTSW 2 135987912 splice site probably benign
R1187:Plcb4 UTSW 2 135968394 missense probably benign 0.36
R1235:Plcb4 UTSW 2 135972948 missense probably damaging 1.00
R1445:Plcb4 UTSW 2 136000189 missense possibly damaging 0.90
R1562:Plcb4 UTSW 2 135970447 critical splice donor site probably null
R1594:Plcb4 UTSW 2 135970390 splice site probably benign
R1920:Plcb4 UTSW 2 136013027 missense probably damaging 1.00
R2041:Plcb4 UTSW 2 135938271 missense probably damaging 1.00
R2141:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2142:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2202:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2203:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2204:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2250:Plcb4 UTSW 2 135971861 critical splice donor site probably null
R2291:Plcb4 UTSW 2 135939983 missense probably benign 0.08
R2326:Plcb4 UTSW 2 135939973 missense probably damaging 0.99
R2442:Plcb4 UTSW 2 135950382 missense probably damaging 1.00
R2939:Plcb4 UTSW 2 135939203 splice site probably benign
R3774:Plcb4 UTSW 2 135958145 missense probably benign 0.00
R3875:Plcb4 UTSW 2 136002632 missense probably damaging 0.99
R4594:Plcb4 UTSW 2 136002599 missense probably damaging 0.98
R4673:Plcb4 UTSW 2 135932271 missense possibly damaging 0.68
R4812:Plcb4 UTSW 2 136007881 missense probably damaging 1.00
R5084:Plcb4 UTSW 2 136002651 missense probably damaging 1.00
R5468:Plcb4 UTSW 2 135967152 missense probably damaging 1.00
R5498:Plcb4 UTSW 2 135976172 missense probably damaging 1.00
R5923:Plcb4 UTSW 2 135961814 nonsense probably null
R6241:Plcb4 UTSW 2 135910174 missense possibly damaging 0.80
R6492:Plcb4 UTSW 2 135973071 nonsense probably null
R6514:Plcb4 UTSW 2 135954996 missense probably benign 0.22
R6570:Plcb4 UTSW 2 135982986 missense probably benign 0.13
R6721:Plcb4 UTSW 2 135910237 missense probably benign 0.01
R6915:Plcb4 UTSW 2 135947115 missense possibly damaging 0.84
R6991:Plcb4 UTSW 2 135910194 missense probably damaging 1.00
R7040:Plcb4 UTSW 2 135932262 missense probably benign
R7086:Plcb4 UTSW 2 136007847 missense probably benign
R7114:Plcb4 UTSW 2 135982123 critical splice donor site probably null
R7249:Plcb4 UTSW 2 136007821 critical splice acceptor site probably null
R7264:Plcb4 UTSW 2 135965080 missense probably benign
R7361:Plcb4 UTSW 2 135976148 missense possibly damaging 0.82
R7426:Plcb4 UTSW 2 136000219 missense probably benign 0.00
R7429:Plcb4 UTSW 2 135968322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCAGTAGATTGGCAGTG -3'
(R):5'- CCCAATGTTCTTGTGGAATTCG -3'

Sequencing Primer
(F):5'- CATAGCGCTGTAAAATGGTGTCCC -3'
(R):5'- AATTCGGGGTCACTGGACATTAGC -3'
Posted On2019-10-07