Incidental Mutation 'R7430:Fgb'
ID576370
Institutional Source Beutler Lab
Gene Symbol Fgb
Ensembl Gene ENSMUSG00000033831
Gene Namefibrinogen beta chain
Synonyms2510049G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R7430 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83040141-83049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83046707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 75 (V75I)
Ref Sequence ENSEMBL: ENSMUSP00000039472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048246]
Predicted Effect probably benign
Transcript: ENSMUST00000048246
AA Change: V75I

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039472
Gene: ENSMUSG00000033831
AA Change: V75I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Fib_alpha 80 225 1.28e-64 SMART
FBG 226 477 1.6e-140 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded preproprotein is proteolytically processed by thrombin to release an N-terminal fibrinopeptide during the conversion of fibrinogen to insoluble fibrin polymer. The encoded protein interacts with the amyloid beta peptide to form fibrin clots of abnormal structure, and may play an important role in Alzheimer's disease. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G C 17: 24,364,958 probably null Het
Ankrd17 C G 5: 90,295,657 E384Q possibly damaging Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
C2cd4d G A 3: 94,364,350 V308M possibly damaging Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Card6 G T 15: 5,099,200 Q905K probably benign Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dnah8 T C 17: 30,706,389 F1266S probably damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fat4 T A 3: 38,887,450 I164N probably damaging Het
Fat4 A G 3: 39,009,644 D4583G probably damaging Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Gclm G A 3: 122,246,080 R32Q probably benign Het
Grsf1 A T 5: 88,663,227 I428N possibly damaging Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hscb T A 5: 110,829,158 I223L probably benign Het
Ifi204 C T 1: 173,755,681 A324T probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lor C T 3: 92,081,899 G27S unknown Het
Lpin3 A G 2: 160,898,666 D377G probably benign Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myh1 C T 11: 67,205,567 Q291* probably null Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Nkx6-2 T C 7: 139,582,000 T154A probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Ovgp1 G C 3: 105,986,302 A464P probably damaging Het
Ovgp1 C T 3: 105,986,303 A464V possibly damaging Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Per2 C A 1: 91,423,983 E934* probably null Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Pifo T C 3: 106,014,518 R30G probably benign Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Postn T A 3: 54,370,202 V206D probably damaging Het
Prss29 T A 17: 25,321,139 probably null Het
Ptges3l C A 11: 101,423,815 V85L possibly damaging Het
Riok2 T C 17: 17,387,540 L450S probably benign Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Slco1a5 A T 6: 142,248,712 S402T probably benign Het
Smad2 T A 18: 76,288,080 V160E probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Tmem120a T A 5: 135,736,136 probably null Het
Tmem161b A G 13: 84,282,747 probably null Het
Trim33 T C 3: 103,310,903 I256T possibly damaging Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
Tufm A G 7: 126,489,127 D228G probably benign Het
Usf1 T A 1: 171,417,727 S236T probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Usp46 T A 5: 74,003,188 Y296F probably damaging Het
Vmn2r82 A G 10: 79,381,253 N473S probably damaging Het
Washc5 A T 15: 59,369,913 Y51* probably null Het
Zfp651 G A 9: 121,763,666 D351N probably benign Het
Zfp763 T A 17: 33,019,532 Y213F possibly damaging Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Fgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Fgb APN 3 83043291 missense possibly damaging 0.95
IGL02129:Fgb APN 3 83043418 missense probably benign 0.05
IGL02148:Fgb APN 3 83043287 missense probably damaging 0.99
IGL02286:Fgb APN 3 83043326 missense probably benign
IGL02601:Fgb APN 3 83045060 missense probably benign 0.06
IGL02721:Fgb APN 3 83043367 missense possibly damaging 0.89
R1217:Fgb UTSW 3 83043257 missense probably damaging 0.99
R1424:Fgb UTSW 3 83046763 missense probably damaging 0.99
R1913:Fgb UTSW 3 83044980 missense probably benign 0.03
R1990:Fgb UTSW 3 83044253 nonsense probably null
R2063:Fgb UTSW 3 83049689 missense probably benign 0.09
R2065:Fgb UTSW 3 83049689 missense probably benign 0.09
R2066:Fgb UTSW 3 83049689 missense probably benign 0.09
R2067:Fgb UTSW 3 83049689 missense probably benign 0.09
R2251:Fgb UTSW 3 83043284 missense probably damaging 1.00
R4682:Fgb UTSW 3 83043265 missense probably benign 0.00
R5045:Fgb UTSW 3 83043373 missense probably damaging 1.00
R5573:Fgb UTSW 3 83049677 splice site probably null
R5766:Fgb UTSW 3 83046176 missense probably damaging 1.00
R6103:Fgb UTSW 3 83043863 missense probably benign 0.22
R6315:Fgb UTSW 3 83045055 missense probably benign 0.00
R6469:Fgb UTSW 3 83046142 nonsense probably null
R6664:Fgb UTSW 3 83046759 missense probably damaging 1.00
R6725:Fgb UTSW 3 83043791 missense probably damaging 1.00
R6727:Fgb UTSW 3 83046787 missense possibly damaging 0.62
R6830:Fgb UTSW 3 83045025 missense probably benign 0.07
R7016:Fgb UTSW 3 83046064 missense probably benign 0.01
R7132:Fgb UTSW 3 83046746 nonsense probably null
R7371:Fgb UTSW 3 83046052 missense probably damaging 0.99
R7681:Fgb UTSW 3 83049832 start gained probably benign
R7811:Fgb UTSW 3 83049697 missense probably benign
Z1177:Fgb UTSW 3 83045056 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGATGCCCAAATACCCTAG -3'
(R):5'- ACCTTGCACTGCGATCTTGC -3'

Sequencing Primer
(F):5'- GATGCCCAAATACCCTAGTTTGG -3'
(R):5'- GATCTTGCCCGATTCCAGACG -3'
Posted On2019-10-07