Incidental Mutation 'R7430:BC028528'
ID576373
Institutional Source Beutler Lab
Gene Symbol BC028528
Ensembl Gene ENSMUSG00000038543
Gene NamecDNA sequence BC028528
SynonymsL259
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7430 (G1)
Quality Score214.458
Status Not validated
Chromosome3
Chromosomal Location95883954-95892005 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT at 95888136 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036360] [ENSMUST00000090476] [ENSMUST00000171519]
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G C 17: 24,364,958 probably null Het
Ankrd17 C G 5: 90,295,657 E384Q possibly damaging Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
C2cd4d G A 3: 94,364,350 V308M possibly damaging Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Card6 G T 15: 5,099,200 Q905K probably benign Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dnah8 T C 17: 30,706,389 F1266S probably damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fat4 T A 3: 38,887,450 I164N probably damaging Het
Fat4 A G 3: 39,009,644 D4583G probably damaging Het
Fgb C T 3: 83,046,707 V75I probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Gclm G A 3: 122,246,080 R32Q probably benign Het
Grsf1 A T 5: 88,663,227 I428N possibly damaging Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hscb T A 5: 110,829,158 I223L probably benign Het
Ifi204 C T 1: 173,755,681 A324T probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lor C T 3: 92,081,899 G27S unknown Het
Lpin3 A G 2: 160,898,666 D377G probably benign Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myh1 C T 11: 67,205,567 Q291* probably null Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Nkx6-2 T C 7: 139,582,000 T154A probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Ovgp1 G C 3: 105,986,302 A464P probably damaging Het
Ovgp1 C T 3: 105,986,303 A464V possibly damaging Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Per2 C A 1: 91,423,983 E934* probably null Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Pifo T C 3: 106,014,518 R30G probably benign Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Postn T A 3: 54,370,202 V206D probably damaging Het
Prss29 T A 17: 25,321,139 probably null Het
Ptges3l C A 11: 101,423,815 V85L possibly damaging Het
Riok2 T C 17: 17,387,540 L450S probably benign Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Slco1a5 A T 6: 142,248,712 S402T probably benign Het
Smad2 T A 18: 76,288,080 V160E probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Tmem120a T A 5: 135,736,136 probably null Het
Tmem161b A G 13: 84,282,747 probably null Het
Trim33 T C 3: 103,310,903 I256T possibly damaging Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
Tufm A G 7: 126,489,127 D228G probably benign Het
Usf1 T A 1: 171,417,727 S236T probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Usp46 T A 5: 74,003,188 Y296F probably damaging Het
Vmn2r82 A G 10: 79,381,253 N473S probably damaging Het
Washc5 A T 15: 59,369,913 Y51* probably null Het
Zfp651 G A 9: 121,763,666 D351N probably benign Het
Zfp763 T A 17: 33,019,532 Y213F possibly damaging Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in BC028528
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:BC028528 APN 3 95888900 missense probably damaging 1.00
R0157:BC028528 UTSW 3 95884968 critical splice donor site probably null
R0164:BC028528 UTSW 3 95887334 intron probably benign
R0306:BC028528 UTSW 3 95889820 unclassified probably benign
R1478:BC028528 UTSW 3 95891959 unclassified probably null
R4204:BC028528 UTSW 3 95889745 nonsense probably null
R4649:BC028528 UTSW 3 95888265 missense probably damaging 0.99
R5022:BC028528 UTSW 3 95888823 intron probably benign
R6541:BC028528 UTSW 3 95888218 missense probably benign 0.00
R6683:BC028528 UTSW 3 95888227 missense probably damaging 1.00
R6980:BC028528 UTSW 3 95888136 small insertion probably benign
R6980:BC028528 UTSW 3 95888139 small insertion probably benign
R6980:BC028528 UTSW 3 95888168 small insertion probably benign
R7058:BC028528 UTSW 3 95885011 missense possibly damaging 0.84
R7180:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888152 small insertion probably benign
R7308:BC028528 UTSW 3 95888169 small insertion probably benign
R7310:BC028528 UTSW 3 95888136 small insertion probably benign
R7310:BC028528 UTSW 3 95888139 small insertion probably benign
R7310:BC028528 UTSW 3 95888148 small insertion probably benign
R7310:BC028528 UTSW 3 95888173 small insertion probably benign
R7356:BC028528 UTSW 3 95888136 small insertion probably benign
R7356:BC028528 UTSW 3 95888141 small insertion probably benign
R7356:BC028528 UTSW 3 95888158 small insertion probably benign
R7356:BC028528 UTSW 3 95888165 small insertion probably benign
R7356:BC028528 UTSW 3 95888175 small insertion probably benign
R7356:BC028528 UTSW 3 95888183 small insertion probably benign
R7376:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888169 small insertion probably benign
R7490:BC028528 UTSW 3 95888136 small insertion probably benign
R7490:BC028528 UTSW 3 95888166 small insertion probably benign
R7490:BC028528 UTSW 3 95888186 small insertion probably benign
R7491:BC028528 UTSW 3 95888136 small insertion probably benign
R7491:BC028528 UTSW 3 95888138 small insertion probably benign
R7496:BC028528 UTSW 3 95888177 small insertion probably benign
R7497:BC028528 UTSW 3 95888136 small insertion probably benign
R7497:BC028528 UTSW 3 95888171 small insertion probably benign
R7498:BC028528 UTSW 3 95888136 small insertion probably benign
R7498:BC028528 UTSW 3 95888182 small insertion probably benign
R7552:BC028528 UTSW 3 95888169 small insertion probably benign
R7565:BC028528 UTSW 3 95888136 small insertion probably benign
R7565:BC028528 UTSW 3 95888138 small insertion probably benign
R7565:BC028528 UTSW 3 95888144 small insertion probably benign
R7566:BC028528 UTSW 3 95888136 small insertion probably benign
R7566:BC028528 UTSW 3 95888145 small insertion probably benign
R7568:BC028528 UTSW 3 95888136 small insertion probably benign
R7568:BC028528 UTSW 3 95888151 small insertion probably benign
R7568:BC028528 UTSW 3 95888172 small insertion probably benign
R7569:BC028528 UTSW 3 95888136 small insertion probably benign
R7580:BC028528 UTSW 3 95888136 small insertion probably benign
R7580:BC028528 UTSW 3 95888140 small insertion probably benign
R7635:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888143 small insertion probably benign
R7672:BC028528 UTSW 3 95888175 small insertion probably benign
R7685:BC028528 UTSW 3 95888136 small insertion probably benign
R7685:BC028528 UTSW 3 95888153 small insertion probably benign
R7685:BC028528 UTSW 3 95888156 small insertion probably benign
R7685:BC028528 UTSW 3 95888183 nonsense probably null
R7686:BC028528 UTSW 3 95888136 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTCCTCTGTCCTCAACACAG -3'
(R):5'- ACTGTTTCCCAATCCTACCGAGG -3'

Sequencing Primer
(F):5'- CAATTGGAGAATTGCCTCTGTCAG -3'
(R):5'- TCCTACCGAGGGCAGAACAG -3'
Posted On2019-10-07