Mutagenetix > Incidental Mutation

Incidental Mutation 'R0627:Slc8a3'

57640

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

038816-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0627 (G1)

Quality Score

192

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81314842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 401 (D401V)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064594
AA Change: D401V

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: D401V

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: D401V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: D401V

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: D401V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: D401V

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Meta Mutation Damage Score

0.3711

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.2%
20x: 94.2%

Validation Efficiency

99% (111/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	G	1: 26,685,889	M70T	probably benign	Het
Adm2	T	A	15: 89,324,305	Y149*	probably null	Het
Ahi1	G	A	10: 20,965,522	R236H	probably benign	Het
Armcx4	A	G	X: 134,695,823	N2160S	possibly damaging	Het
Asns	A	T	6: 7,675,516	D495E	probably benign	Het
Bcl9	A	G	3: 97,205,473	V1222A	probably damaging	Het
Cd46	A	T	1: 195,092,186	C14S	probably benign	Het
Cdk11b	T	A	4: 155,640,772		probably benign	Het
Cdkl3	T	C	11: 52,011,308	Y115H	probably damaging	Het
Cep41	C	A	6: 30,656,631	C274F	probably damaging	Het
Ces1a	C	A	8: 93,042,043	V108F	probably benign	Het
Clca4b	A	G	3: 144,928,259	Y132H	probably benign	Het
Col5a3	T	C	9: 20,775,485	E1323G	unknown	Het
Cttnbp2	A	G	6: 18,367,373	*1139Q	probably null	Het
Cyp2d9	T	A	15: 82,455,790	I127N	probably damaging	Het
Dennd1b	A	G	1: 139,081,219	Y220C	probably damaging	Het
Desi2	T	C	1: 178,249,352	S141P	possibly damaging	Het
Dgcr2	A	G	16: 17,844,008	S453P	probably damaging	Het
Dnah3	A	G	7: 120,020,915	L1586P	probably damaging	Het
Dpep3	T	C	8: 105,978,731	D129G	possibly damaging	Het
Eci3	C	T	13: 34,948,143	V241I	possibly damaging	Het
Ecm2	A	T	13: 49,521,083		probably benign	Het
Emilin3	A	G	2: 160,908,176	L551P	probably damaging	Het
Erap1	A	C	13: 74,675,814		probably benign	Het
Ern1	T	C	11: 106,398,693	D928G	probably benign	Het
Fam214b	G	T	4: 43,036,242	P163Q	probably damaging	Het
Fancc	C	A	13: 63,317,478	A472S	probably damaging	Het
Fkbp7	A	T	2: 76,672,844	D57E	probably damaging	Het
Gabbr2	T	A	4: 46,681,223	I703F	possibly damaging	Het
Gabrg3	A	T	7: 56,724,595	C408S	probably damaging	Het
Gm13119	C	A	4: 144,362,846	L245I	probably benign	Het
Gm13757	A	G	2: 88,446,219	S240P	probably damaging	Het
Gm8674	T	C	13: 49,899,715		noncoding transcript	Het
Gnas	G	A	2: 174,298,135		probably benign	Het
Grhl3	A	G	4: 135,552,681	V354A	probably benign	Het
Gsdme	G	T	6: 50,229,279		probably benign	Het
H2-D1	A	G	17: 35,265,922	E253G	probably damaging	Het
Habp2	A	G	19: 56,314,046	T31A	probably damaging	Het
Ifrd1	A	G	12: 40,206,987		probably null	Het
Il20	A	G	1: 130,909,739		probably benign	Het
Isx	A	T	8: 74,892,700	I160F	possibly damaging	Het
Itgb2l	T	G	16: 96,422,911		probably benign	Het
Kcnv1	T	G	15: 45,112,881		probably benign	Het
Kif17	T	C	4: 138,288,487		probably null	Het
Kirrel3	A	C	9: 35,035,174	D743A	probably damaging	Het
Lmod3	T	C	6: 97,248,071	D263G	probably damaging	Het
Manf	A	G	9: 106,889,186	L132P	probably damaging	Het
Mark2	C	T	19: 7,281,960		probably null	Het
Med10	G	A	13: 69,815,601	S107N	possibly damaging	Het
Med31	A	G	11: 72,213,775		probably null	Het
Mki67	C	A	7: 135,708,258	A155S	probably benign	Het
Mprip	T	A	11: 59,769,972	L2193Q	probably damaging	Het
Mylk	A	G	16: 35,000,429	N126S	probably damaging	Het
Myo16	A	G	8: 10,439,689	I715V	probably benign	Het
Myo18b	T	C	5: 112,798,834	T1591A	probably benign	Het
Myt1	T	A	2: 181,795,689	D64E	probably benign	Het
Ndufa10	A	T	1: 92,469,896	Y61N	probably damaging	Het
Nob1	A	G	8: 107,416,224	F275S	probably damaging	Het
Nop2	T	C	6: 125,139,704	V333A	possibly damaging	Het
Ogdh	T	A	11: 6,347,216	V545D	possibly damaging	Het
Olfr1101	T	C	2: 86,989,014	N54S	probably benign	Het
Olfr1461	A	G	19: 13,165,250	T79A	probably benign	Het
Olfr213	T	A	6: 116,540,988	N178K	possibly damaging	Het
Olfr364-ps1	T	G	2: 37,146,330	N39K	probably damaging	Het
Olfr430	G	T	1: 174,070,077	V260F	probably damaging	Het
Olfr826	A	G	10: 130,180,688	F64S	probably damaging	Het
Pcdhb1	T	C	18: 37,265,721	F242L	probably damaging	Het
Pkd2l2	A	G	18: 34,425,102	Y278C	probably damaging	Het
Plxdc1	T	A	11: 97,932,204		probably null	Het
Ppp2r5b	A	G	19: 6,232,634		probably benign	Het
Prelid2	T	A	18: 41,937,652	T39S	possibly damaging	Het
Prkd1	A	T	12: 50,490,041	F87I	probably benign	Het
Prl3d3	C	T	13: 27,156,847	T4I	probably damaging	Het
Proser3	T	A	7: 30,540,783	T299S	probably benign	Het
Ptprc	G	T	1: 138,068,320	H1095N	probably damaging	Het
Rab11fip5	G	T	6: 85,348,051	P425T	probably benign	Het
Rac2	T	C	15: 78,564,968	T115A	probably damaging	Het
Rtl9	C	A	X: 143,101,275	T561K	possibly damaging	Het
Runx2	T	C	17: 44,658,505		probably benign	Het
Rxfp1	C	T	3: 79,648,211	V613I	probably benign	Het
Scn9a	T	C	2: 66,537,377	K656R	probably benign	Het
Sec31b	A	G	19: 44,525,607	S406P	probably benign	Het
Sept5	T	C	16: 18,625,365	D44G	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc35c2	T	C	2: 165,282,136	T94A	possibly damaging	Het
Slitrk1	A	T	14: 108,912,239	C347S	probably damaging	Het
Smg1	G	T	7: 118,167,861		probably benign	Het
Snx14	T	C	9: 88,394,430	K610E	probably benign	Het
Sppl2a	A	G	2: 126,920,417		probably benign	Het
Stk-ps2	T	A	1: 46,029,691		noncoding transcript	Het
Sult3a1	T	C	10: 33,864,014	M23T	probably benign	Het
Syt5	A	G	7: 4,545,683	L50P	possibly damaging	Het
Tacr1	A	G	6: 82,555,031	I303V	possibly damaging	Het
Trip12	C	A	1: 84,768,597	V487F	probably damaging	Het
Vcp	A	G	4: 42,983,011	S612P	possibly damaging	Het
Vmn1r47	A	G	6: 90,022,806	I307V	probably null	Het
Vmn1r83	T	G	7: 12,321,992	D46A	probably damaging	Het
Vmn2r118	G	T	17: 55,610,772	Q247K	probably benign	Het
Vmn2r94	C	T	17: 18,257,165	C328Y	probably damaging	Het
Vps13b	T	A	15: 35,371,999	Y13*	probably null	Het
Vps13d	C	T	4: 145,087,184	R3241H	probably damaging	Het
Wdr5b	A	G	16: 36,042,470	T320A	probably benign	Het
Zfhx2	A	T	14: 55,065,327	D1733E	probably benign	Het
Zfp541	A	G	7: 16,095,682		probably benign	Het
Zfp708	A	T	13: 67,070,717	Y314*	probably null	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TACACGGACATTGCTCAGCCTCAC -3'
(R):5'- AACAGAAGAGCCGTGCTTTCTACC -3'

Sequencing Primer
(F):5'- ACAGAGAACTCCTTCTGGGTC -3'
(R):5'- GTGCTTTCTACCGCATCCAAG -3'

Posted On

2013-07-11