Incidental Mutation 'R7430:Marveld3'
ID576401
Institutional Source Beutler Lab
Gene Symbol Marveld3
Ensembl Gene ENSMUSG00000001672
Gene NameMARVEL (membrane-associating) domain containing 3
Synonyms1810006A16Rik, MARVD3, Mrvldc3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7430 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location109947914-109962203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109948468 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 239 (S239P)
Ref Sequence ENSEMBL: ENSMUSP00000001722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001722] [ENSMUST00000034175] [ENSMUST00000051430] [ENSMUST00000179721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001722
AA Change: S239P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001722
Gene: ENSMUSG00000001672
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000034175
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051430
SMART Domains Protein: ENSMUSP00000052309
Gene: ENSMUSG00000001672

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
Pfam:MARVEL 168 355 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179721
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G C 17: 24,364,958 probably null Het
Ankrd17 C G 5: 90,295,657 E384Q possibly damaging Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTC 3: 95,888,169 probably benign Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
C2cd4d G A 3: 94,364,350 V308M possibly damaging Het
Calcr A G 6: 3,708,586 L200S probably damaging Het
Card6 G T 15: 5,099,200 Q905K probably benign Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dnah8 T C 17: 30,706,389 F1266S probably damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fat4 T A 3: 38,887,450 I164N probably damaging Het
Fat4 A G 3: 39,009,644 D4583G probably damaging Het
Fgb C T 3: 83,046,707 V75I probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Gclm G A 3: 122,246,080 R32Q probably benign Het
Grsf1 A T 5: 88,663,227 I428N possibly damaging Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hscb T A 5: 110,829,158 I223L probably benign Het
Ifi204 C T 1: 173,755,681 A324T probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Lor C T 3: 92,081,899 G27S unknown Het
Lpin3 A G 2: 160,898,666 D377G probably benign Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myh1 C T 11: 67,205,567 Q291* probably null Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Nkx6-2 T C 7: 139,582,000 T154A probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Ovgp1 G C 3: 105,986,302 A464P probably damaging Het
Ovgp1 C T 3: 105,986,303 A464V possibly damaging Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Per2 C A 1: 91,423,983 E934* probably null Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Pifo T C 3: 106,014,518 R30G probably benign Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Postn T A 3: 54,370,202 V206D probably damaging Het
Prss29 T A 17: 25,321,139 probably null Het
Ptges3l C A 11: 101,423,815 V85L possibly damaging Het
Riok2 T C 17: 17,387,540 L450S probably benign Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Slco1a5 A T 6: 142,248,712 S402T probably benign Het
Smad2 T A 18: 76,288,080 V160E probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Tmem120a T A 5: 135,736,136 probably null Het
Tmem161b A G 13: 84,282,747 probably null Het
Trim33 T C 3: 103,310,903 I256T possibly damaging Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
Tufm A G 7: 126,489,127 D228G probably benign Het
Usf1 T A 1: 171,417,727 S236T probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Usp46 T A 5: 74,003,188 Y296F probably damaging Het
Vmn2r82 A G 10: 79,381,253 N473S probably damaging Het
Washc5 A T 15: 59,369,913 Y51* probably null Het
Zfp651 G A 9: 121,763,666 D351N probably benign Het
Zfp763 T A 17: 33,019,532 Y213F possibly damaging Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Marveld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Marveld3 APN 8 109961964 missense possibly damaging 0.81
IGL01341:Marveld3 APN 8 109948417 missense possibly damaging 0.94
IGL01415:Marveld3 APN 8 109962073 missense possibly damaging 0.92
IGL01759:Marveld3 APN 8 109948087 missense possibly damaging 0.90
IGL02012:Marveld3 APN 8 109948132 missense probably damaging 0.99
R0732:Marveld3 UTSW 8 109948483 missense probably damaging 0.99
R1500:Marveld3 UTSW 8 109948542 splice site probably null
R1955:Marveld3 UTSW 8 109959748 missense probably benign 0.08
R2146:Marveld3 UTSW 8 109959802 missense probably benign 0.00
R2172:Marveld3 UTSW 8 109961846 missense probably benign 0.22
R4843:Marveld3 UTSW 8 109962070 missense possibly damaging 0.66
R4925:Marveld3 UTSW 8 109948311 missense probably benign 0.00
R5542:Marveld3 UTSW 8 109948617 missense probably benign 0.03
R6003:Marveld3 UTSW 8 109954328 missense probably damaging 1.00
R6733:Marveld3 UTSW 8 109962049 missense possibly damaging 0.90
R6786:Marveld3 UTSW 8 109948100 missense probably benign 0.13
R7156:Marveld3 UTSW 8 109948188 missense probably damaging 1.00
R7194:Marveld3 UTSW 8 109959845 splice site probably null
R7429:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7810:Marveld3 UTSW 8 109954634 missense probably damaging 0.99
R8421:Marveld3 UTSW 8 109948647 missense probably benign 0.07
R8460:Marveld3 UTSW 8 109954408 missense probably benign 0.16
R8478:Marveld3 UTSW 8 109961968 missense probably damaging 1.00
Z1088:Marveld3 UTSW 8 109948063 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGGTGGAATTGATGCGCAAC -3'
(R):5'- CCTAGGTGTGGTGCAGATAATG -3'

Sequencing Primer
(F):5'- CCGCATACAGGTAAAAGCCAATGG -3'
(R):5'- AGATAATGGAGGTGATTTTGAATGCC -3'
Posted On2019-10-07