Incidental Mutation 'R7431:Atg4c'
ID576453
Institutional Source Beutler Lab
Gene Symbol Atg4c
Ensembl Gene ENSMUSG00000028550
Gene Nameautophagy related 4C, cysteine peptidase
SynonymsApg4-C, autophagin 3, Apg4c, Autl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7431 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location99193934-99259787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99221395 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 200 (I200F)
Ref Sequence ENSEMBL: ENSMUSP00000030279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030279] [ENSMUST00000180278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030279
AA Change: I200F

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030279
Gene: ENSMUSG00000028550
AA Change: I200F

DomainStartEndE-ValueType
Pfam:Peptidase_C54 76 400 7.4e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000180278
AA Change: I200F

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137035
Gene: ENSMUSG00000028550
AA Change: I200F

DomainStartEndE-ValueType
Pfam:Peptidase_C54 73 402 1.4e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding the same protein, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a higher incidence of chemically-induced fibrosarcomas, and exhibit both a significant reduction of autophagic activity in the diaphragm muscle as well as decreased locomotor activity after prolonged starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,881,837 H10R probably benign Het
4931406P16Rik T C 7: 34,284,794 I135V possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Abcf3 G T 16: 20,558,789 R510L probably benign Het
Abcg4 T A 9: 44,274,700 I625F possibly damaging Het
Adam22 A T 5: 8,092,818 S806T probably damaging Het
Adcy4 T C 14: 55,772,672 I718V probably benign Het
Adgb A T 10: 10,391,955 probably null Het
Aldoart1 T A 4: 72,851,441 K377* probably null Het
Apc2 T A 10: 80,302,183 V100E possibly damaging Het
Asxl3 T G 18: 22,516,953 D666E probably damaging Het
Atp1a4 A G 1: 172,250,907 F255L probably benign Het
Bod1l A C 5: 41,813,120 probably null Het
Cacna2d4 A T 6: 119,244,276 T250S probably damaging Het
Ccdc114 T G 7: 45,929,246 L81R probably damaging Het
Ccng1 G A 11: 40,753,918 R51W possibly damaging Het
Chd6 T C 2: 161,026,328 E366G possibly damaging Het
Clca4b A T 3: 144,911,133 S919T probably benign Het
Col5a3 T C 9: 20,770,835 *1740W probably null Het
Col6a5 A T 9: 105,928,269 I1146K unknown Het
Cpxm1 T C 2: 130,394,046 T399A probably benign Het
Cpz T C 5: 35,511,142 T375A probably benign Het
Cyp2b13 T A 7: 26,061,551 V11D probably damaging Het
Cyp39a1 A G 17: 43,683,015 T189A probably benign Het
Desi2 C T 1: 178,256,441 Q52* probably null Het
Dhx15 A G 5: 52,162,611 V418A probably damaging Het
Dnah3 T A 7: 120,051,744 M978L probably damaging Het
Dpagt1 T A 9: 44,326,087 C17* probably null Het
Dph5 A T 3: 115,892,732 K52N possibly damaging Het
Dpp4 G T 2: 62,352,238 N566K probably benign Het
Elavl4 T C 4: 110,226,633 Y94C probably damaging Het
Fat2 G A 11: 55,309,101 T1049I probably damaging Het
Fat4 T A 3: 39,009,157 Y4421N possibly damaging Het
Fcrls C A 3: 87,258,926 A181S probably damaging Het
Glg1 G T 8: 111,160,754 N456K unknown Het
Gm10228 A G 16: 89,041,213 S68P unknown Het
Golga4 G A 9: 118,559,731 E1974K probably damaging Het
Heatr9 G T 11: 83,519,268 P49Q probably damaging Het
Hmgxb3 A T 18: 61,147,445 V662D probably damaging Het
Hs3st4 T C 7: 123,983,290 L37P probably damaging Het
Ifi205 A T 1: 174,028,377 M29K probably benign Het
Igkv1-35 C T 6: 70,011,004 V103M probably damaging Het
Klf13 T A 7: 63,891,756 K208* probably null Het
Klhl36 A G 8: 119,870,382 N274S probably benign Het
Mosmo T A 7: 120,730,650 L165I probably benign Het
Mtcl1 G A 17: 66,342,906 Q1855* probably null Het
Muc16 A G 9: 18,607,993 V208A Het
Nin T G 12: 70,078,223 R108S Het
Olfr159 T C 4: 43,770,882 N43S probably damaging Het
Polr1a G A 6: 71,926,659 V319I probably benign Het
Pramel7 A G 2: 87,489,938 V337A possibly damaging Het
Prkar2b A T 12: 31,963,151 probably null Het
R3hdm2 T A 10: 127,458,147 M170K probably benign Het
Rbm26 A G 14: 105,117,092 I919T possibly damaging Het
Rimkla A G 4: 119,477,811 M125T probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Sbf2 G T 7: 110,351,750 D1163E probably damaging Het
Scgb2b24 T C 7: 33,739,249 I13V probably benign Het
Scin G A 12: 40,133,922 H63Y probably damaging Het
Sele A G 1: 164,051,620 T275A probably damaging Het
Slc22a15 T A 3: 101,897,940 T144S probably benign Het
Slc8a1 T A 17: 81,441,663 K650I probably benign Het
Slc9c1 G T 16: 45,593,484 V992F probably damaging Het
Spag16 A T 1: 69,923,872 T393S unknown Het
Taf15 G A 11: 83,504,953 D495N unknown Het
Tas2r144 T A 6: 42,215,974 I216N probably damaging Het
Tbccd1 G T 16: 22,825,813 P271Q probably benign Het
Tcf4 C A 18: 69,347,178 probably null Het
Thap4 A T 1: 93,750,501 S188T probably benign Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trip11 A G 12: 101,884,019 V1262A possibly damaging Het
Tspan2 T A 3: 102,749,791 W35R probably damaging Het
Usp39 G T 6: 72,336,268 T313N possibly damaging Het
Vmn2r83 T A 10: 79,491,472 L638Q probably damaging Het
Vps29 T C 5: 122,354,478 V2A probably benign Het
Wrap53 A G 11: 69,578,487 F148L possibly damaging Het
Znfx1 T C 2: 167,055,792 Y404C probably damaging Het
Zrsr1 A G 11: 22,973,580 E118G probably benign Het
Other mutations in Atg4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Atg4c APN 4 99218203 splice site probably benign
IGL02969:Atg4c APN 4 99258387 splice site probably benign
IGL03233:Atg4c APN 4 99229503 missense probably benign 0.06
R0083:Atg4c UTSW 4 99221440 missense possibly damaging 0.74
R0108:Atg4c UTSW 4 99221440 missense possibly damaging 0.74
R0485:Atg4c UTSW 4 99224482 missense probably benign 0.13
R1488:Atg4c UTSW 4 99221242 missense probably damaging 1.00
R1983:Atg4c UTSW 4 99228575 missense probably damaging 1.00
R2036:Atg4c UTSW 4 99218139 missense possibly damaging 0.89
R2146:Atg4c UTSW 4 99221226 missense possibly damaging 0.89
R2148:Atg4c UTSW 4 99221226 missense possibly damaging 0.89
R2150:Atg4c UTSW 4 99221226 missense possibly damaging 0.89
R5715:Atg4c UTSW 4 99258402 missense probably damaging 1.00
R5854:Atg4c UTSW 4 99228559 missense probably benign
R6157:Atg4c UTSW 4 99235163 nonsense probably null
R7570:Atg4c UTSW 4 99228560 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGAGAACGCAGACTCTGACTC -3'
(R):5'- GCTTTCATGGAGCTGCTCTTAAG -3'

Sequencing Primer
(F):5'- GCAGACTCTGACTCATGGAC -3'
(R):5'- CTCAGTCAAAGTTGGTATTTCCCAG -3'
Posted On2019-10-07