Incidental Mutation 'R7431:Scgb2b24'
ID576467
Institutional Source Beutler Lab
Gene Symbol Scgb2b24
Ensembl Gene ENSMUSG00000046438
Gene Namesecretoglobin, family 2B, member 24
SynonymsC2b, Abpbg24, Abpz, Scgb2b3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7431 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location33737190-33739312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33739249 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 13 (I13V)
Ref Sequence ENSEMBL: ENSMUSP00000052456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055444] [ENSMUST00000108087]
Predicted Effect probably benign
Transcript: ENSMUST00000055444
AA Change: I13V

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052456
Gene: ENSMUSG00000046438
AA Change: I13V

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
Pfam:Feld-I_B 24 90 5.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108087
SMART Domains Protein: ENSMUSP00000103722
Gene: ENSMUSG00000078753

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
UTG 23 92 4.95e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,881,837 H10R probably benign Het
4931406P16Rik T C 7: 34,284,794 I135V possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Abcf3 G T 16: 20,558,789 R510L probably benign Het
Abcg4 T A 9: 44,274,700 I625F possibly damaging Het
Adam22 A T 5: 8,092,818 S806T probably damaging Het
Adcy4 T C 14: 55,772,672 I718V probably benign Het
Adgb A T 10: 10,391,955 probably null Het
Aldoart1 T A 4: 72,851,441 K377* probably null Het
Apc2 T A 10: 80,302,183 V100E possibly damaging Het
Asxl3 T G 18: 22,516,953 D666E probably damaging Het
Atg4c A T 4: 99,221,395 I200F possibly damaging Het
Atp1a4 A G 1: 172,250,907 F255L probably benign Het
Bod1l A C 5: 41,813,120 probably null Het
Cacna2d4 A T 6: 119,244,276 T250S probably damaging Het
Ccdc114 T G 7: 45,929,246 L81R probably damaging Het
Ccng1 G A 11: 40,753,918 R51W possibly damaging Het
Chd6 T C 2: 161,026,328 E366G possibly damaging Het
Clca4b A T 3: 144,911,133 S919T probably benign Het
Col5a3 T C 9: 20,770,835 *1740W probably null Het
Col6a5 A T 9: 105,928,269 I1146K unknown Het
Cpxm1 T C 2: 130,394,046 T399A probably benign Het
Cpz T C 5: 35,511,142 T375A probably benign Het
Cyp2b13 T A 7: 26,061,551 V11D probably damaging Het
Cyp39a1 A G 17: 43,683,015 T189A probably benign Het
Desi2 C T 1: 178,256,441 Q52* probably null Het
Dhx15 A G 5: 52,162,611 V418A probably damaging Het
Dnah3 T A 7: 120,051,744 M978L probably damaging Het
Dpagt1 T A 9: 44,326,087 C17* probably null Het
Dph5 A T 3: 115,892,732 K52N possibly damaging Het
Dpp4 G T 2: 62,352,238 N566K probably benign Het
Elavl4 T C 4: 110,226,633 Y94C probably damaging Het
Fat2 G A 11: 55,309,101 T1049I probably damaging Het
Fat4 T A 3: 39,009,157 Y4421N possibly damaging Het
Fcrls C A 3: 87,258,926 A181S probably damaging Het
Glg1 G T 8: 111,160,754 N456K unknown Het
Gm10228 A G 16: 89,041,213 S68P unknown Het
Golga4 G A 9: 118,559,731 E1974K probably damaging Het
Heatr9 G T 11: 83,519,268 P49Q probably damaging Het
Hmgxb3 A T 18: 61,147,445 V662D probably damaging Het
Hs3st4 T C 7: 123,983,290 L37P probably damaging Het
Ifi205 A T 1: 174,028,377 M29K probably benign Het
Igkv1-35 C T 6: 70,011,004 V103M probably damaging Het
Klf13 T A 7: 63,891,756 K208* probably null Het
Klhl36 A G 8: 119,870,382 N274S probably benign Het
Mosmo T A 7: 120,730,650 L165I probably benign Het
Mtcl1 G A 17: 66,342,906 Q1855* probably null Het
Muc16 A G 9: 18,607,993 V208A Het
Nin T G 12: 70,078,223 R108S Het
Olfr159 T C 4: 43,770,882 N43S probably damaging Het
Polr1a G A 6: 71,926,659 V319I probably benign Het
Pramel7 A G 2: 87,489,938 V337A possibly damaging Het
Prkar2b A T 12: 31,963,151 probably null Het
R3hdm2 T A 10: 127,458,147 M170K probably benign Het
Rbm26 A G 14: 105,117,092 I919T possibly damaging Het
Rimkla A G 4: 119,477,811 M125T probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Sbf2 G T 7: 110,351,750 D1163E probably damaging Het
Scin G A 12: 40,133,922 H63Y probably damaging Het
Sele A G 1: 164,051,620 T275A probably damaging Het
Slc22a15 T A 3: 101,897,940 T144S probably benign Het
Slc8a1 T A 17: 81,441,663 K650I probably benign Het
Slc9c1 G T 16: 45,593,484 V992F probably damaging Het
Spag16 A T 1: 69,923,872 T393S unknown Het
Taf15 G A 11: 83,504,953 D495N unknown Het
Tas2r144 T A 6: 42,215,974 I216N probably damaging Het
Tbccd1 G T 16: 22,825,813 P271Q probably benign Het
Tcf4 C A 18: 69,347,178 probably null Het
Thap4 A T 1: 93,750,501 S188T probably benign Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trip11 A G 12: 101,884,019 V1262A possibly damaging Het
Tspan2 T A 3: 102,749,791 W35R probably damaging Het
Usp39 G T 6: 72,336,268 T313N possibly damaging Het
Vmn2r83 T A 10: 79,491,472 L638Q probably damaging Het
Vps29 T C 5: 122,354,478 V2A probably benign Het
Wrap53 A G 11: 69,578,487 F148L possibly damaging Het
Znfx1 T C 2: 167,055,792 Y404C probably damaging Het
Zrsr1 A G 11: 22,973,580 E118G probably benign Het
Other mutations in Scgb2b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Scgb2b24 APN 7 33739227 missense probably damaging 0.97
IGL02328:Scgb2b24 APN 7 33738625 splice site probably benign
PIT4618001:Scgb2b24 UTSW 7 33738611 missense probably damaging 0.96
R3441:Scgb2b24 UTSW 7 33738600 missense probably damaging 1.00
R5874:Scgb2b24 UTSW 7 33737405 missense probably damaging 0.99
R6572:Scgb2b24 UTSW 7 33738477 missense probably damaging 1.00
R6800:Scgb2b24 UTSW 7 33738469 missense probably benign 0.01
R8096:Scgb2b24 UTSW 7 33739221 splice site probably null
R8458:Scgb2b24 UTSW 7 33737354 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACTCACCTCTGCTTCAAGG -3'
(R):5'- AGGTTCTTGCCCCAAGGTATG -3'

Sequencing Primer
(F):5'- GAGTATCATCACCAGCACACTTTTG -3'
(R):5'- CCCAAGGTATGTCGAGCTCTTG -3'
Posted On2019-10-07