Incidental Mutation 'R0627:Zfhx2'
ID57649
Institutional Source Beutler Lab
Gene Symbol Zfhx2
Ensembl Gene ENSMUSG00000040721
Gene Namezinc finger homeobox 2
Synonymszfh-5
MMRRC Submission 038816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R0627 (G1)
Quality Score159
Status Validated
Chromosome14
Chromosomal Location55060262-55092324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55065327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1733 (D1733E)
Ref Sequence ENSEMBL: ENSMUSP00000045156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]
Predicted Effect probably benign
Transcript: ENSMUST00000036328
AA Change: D1733E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: D1733E

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
ZnF_C2H2 230 252 1.43e1 SMART
low complexity region 333 345 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
ZnF_C2H2 446 469 8.94e-3 SMART
ZnF_U1 498 532 6.98e-1 SMART
ZnF_C2H2 501 525 3.21e-4 SMART
ZnF_U1 560 594 1.36e0 SMART
ZnF_C2H2 563 587 3.29e-1 SMART
low complexity region 597 623 N/A INTRINSIC
ZnF_C2H2 752 776 6.4e0 SMART
ZnF_C2H2 815 839 2.02e-1 SMART
ZnF_U1 861 895 1.78e1 SMART
ZnF_C2H2 864 888 5.34e-1 SMART
ZnF_C2H2 974 997 1.51e1 SMART
ZnF_C2H2 1003 1026 1.51e0 SMART
low complexity region 1087 1103 N/A INTRINSIC
low complexity region 1106 1126 N/A INTRINSIC
ZnF_U1 1182 1216 3.42e0 SMART
ZnF_C2H2 1185 1209 8.22e-2 SMART
ZnF_U1 1239 1273 3.73e0 SMART
ZnF_C2H2 1242 1266 6.67e-2 SMART
low complexity region 1277 1304 N/A INTRINSIC
low complexity region 1314 1326 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
low complexity region 1379 1400 N/A INTRINSIC
low complexity region 1457 1465 N/A INTRINSIC
ZnF_C2H2 1474 1497 5.34e0 SMART
low complexity region 1522 1531 N/A INTRINSIC
low complexity region 1542 1554 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
HOX 1589 1651 1.97e-16 SMART
low complexity region 1656 1665 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
ZnF_C2H2 1761 1783 2.53e-2 SMART
low complexity region 1837 1847 N/A INTRINSIC
HOX 1851 1913 2.34e-18 SMART
low complexity region 1984 1995 N/A INTRINSIC
low complexity region 2001 2051 N/A INTRINSIC
HOX 2058 2120 1.52e-17 SMART
ZnF_U1 2136 2170 1.09e1 SMART
ZnF_C2H2 2139 2163 5.4e1 SMART
low complexity region 2328 2354 N/A INTRINSIC
low complexity region 2385 2426 N/A INTRINSIC
ZnF_U1 2482 2516 8.31e-1 SMART
ZnF_C2H2 2485 2509 9.46e0 SMART
low complexity region 2523 2538 N/A INTRINSIC
low complexity region 2553 2562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176665
SMART Domains Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

DomainStartEndE-ValueType
ZnF_C2H2 13 37 5.34e-1 SMART
ZnF_C2H2 133 156 1.51e1 SMART
ZnF_C2H2 162 185 1.51e0 SMART
low complexity region 246 262 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
ZnF_C2H2 344 368 8.22e-2 SMART
ZnF_C2H2 401 425 6.67e-2 SMART
low complexity region 436 463 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 538 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 99% (111/112)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,685,889 M70T probably benign Het
Adm2 T A 15: 89,324,305 Y149* probably null Het
Ahi1 G A 10: 20,965,522 R236H probably benign Het
Armcx4 A G X: 134,695,823 N2160S possibly damaging Het
Asns A T 6: 7,675,516 D495E probably benign Het
Bcl9 A G 3: 97,205,473 V1222A probably damaging Het
Cd46 A T 1: 195,092,186 C14S probably benign Het
Cdk11b T A 4: 155,640,772 probably benign Het
Cdkl3 T C 11: 52,011,308 Y115H probably damaging Het
Cep41 C A 6: 30,656,631 C274F probably damaging Het
Ces1a C A 8: 93,042,043 V108F probably benign Het
Clca4b A G 3: 144,928,259 Y132H probably benign Het
Col5a3 T C 9: 20,775,485 E1323G unknown Het
Cttnbp2 A G 6: 18,367,373 *1139Q probably null Het
Cyp2d9 T A 15: 82,455,790 I127N probably damaging Het
Dennd1b A G 1: 139,081,219 Y220C probably damaging Het
Desi2 T C 1: 178,249,352 S141P possibly damaging Het
Dgcr2 A G 16: 17,844,008 S453P probably damaging Het
Dnah3 A G 7: 120,020,915 L1586P probably damaging Het
Dpep3 T C 8: 105,978,731 D129G possibly damaging Het
Eci3 C T 13: 34,948,143 V241I possibly damaging Het
Ecm2 A T 13: 49,521,083 probably benign Het
Emilin3 A G 2: 160,908,176 L551P probably damaging Het
Erap1 A C 13: 74,675,814 probably benign Het
Ern1 T C 11: 106,398,693 D928G probably benign Het
Fam214b G T 4: 43,036,242 P163Q probably damaging Het
Fancc C A 13: 63,317,478 A472S probably damaging Het
Fkbp7 A T 2: 76,672,844 D57E probably damaging Het
Gabbr2 T A 4: 46,681,223 I703F possibly damaging Het
Gabrg3 A T 7: 56,724,595 C408S probably damaging Het
Gm13119 C A 4: 144,362,846 L245I probably benign Het
Gm13757 A G 2: 88,446,219 S240P probably damaging Het
Gm8674 T C 13: 49,899,715 noncoding transcript Het
Gnas G A 2: 174,298,135 probably benign Het
Grhl3 A G 4: 135,552,681 V354A probably benign Het
Gsdme G T 6: 50,229,279 probably benign Het
H2-D1 A G 17: 35,265,922 E253G probably damaging Het
Habp2 A G 19: 56,314,046 T31A probably damaging Het
Ifrd1 A G 12: 40,206,987 probably null Het
Il20 A G 1: 130,909,739 probably benign Het
Isx A T 8: 74,892,700 I160F possibly damaging Het
Itgb2l T G 16: 96,422,911 probably benign Het
Kcnv1 T G 15: 45,112,881 probably benign Het
Kif17 T C 4: 138,288,487 probably null Het
Kirrel3 A C 9: 35,035,174 D743A probably damaging Het
Lmod3 T C 6: 97,248,071 D263G probably damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Mark2 C T 19: 7,281,960 probably null Het
Med10 G A 13: 69,815,601 S107N possibly damaging Het
Med31 A G 11: 72,213,775 probably null Het
Mki67 C A 7: 135,708,258 A155S probably benign Het
Mprip T A 11: 59,769,972 L2193Q probably damaging Het
Mylk A G 16: 35,000,429 N126S probably damaging Het
Myo16 A G 8: 10,439,689 I715V probably benign Het
Myo18b T C 5: 112,798,834 T1591A probably benign Het
Myt1 T A 2: 181,795,689 D64E probably benign Het
Ndufa10 A T 1: 92,469,896 Y61N probably damaging Het
Nob1 A G 8: 107,416,224 F275S probably damaging Het
Nop2 T C 6: 125,139,704 V333A possibly damaging Het
Ogdh T A 11: 6,347,216 V545D possibly damaging Het
Olfr1101 T C 2: 86,989,014 N54S probably benign Het
Olfr1461 A G 19: 13,165,250 T79A probably benign Het
Olfr213 T A 6: 116,540,988 N178K possibly damaging Het
Olfr364-ps1 T G 2: 37,146,330 N39K probably damaging Het
Olfr430 G T 1: 174,070,077 V260F probably damaging Het
Olfr826 A G 10: 130,180,688 F64S probably damaging Het
Pcdhb1 T C 18: 37,265,721 F242L probably damaging Het
Pkd2l2 A G 18: 34,425,102 Y278C probably damaging Het
Plxdc1 T A 11: 97,932,204 probably null Het
Ppp2r5b A G 19: 6,232,634 probably benign Het
Prelid2 T A 18: 41,937,652 T39S possibly damaging Het
Prkd1 A T 12: 50,490,041 F87I probably benign Het
Prl3d3 C T 13: 27,156,847 T4I probably damaging Het
Proser3 T A 7: 30,540,783 T299S probably benign Het
Ptprc G T 1: 138,068,320 H1095N probably damaging Het
Rab11fip5 G T 6: 85,348,051 P425T probably benign Het
Rac2 T C 15: 78,564,968 T115A probably damaging Het
Rtl9 C A X: 143,101,275 T561K possibly damaging Het
Runx2 T C 17: 44,658,505 probably benign Het
Rxfp1 C T 3: 79,648,211 V613I probably benign Het
Scn9a T C 2: 66,537,377 K656R probably benign Het
Sec31b A G 19: 44,525,607 S406P probably benign Het
Sept5 T C 16: 18,625,365 D44G possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35c2 T C 2: 165,282,136 T94A possibly damaging Het
Slc8a3 T A 12: 81,314,842 D401V probably damaging Het
Slitrk1 A T 14: 108,912,239 C347S probably damaging Het
Smg1 G T 7: 118,167,861 probably benign Het
Snx14 T C 9: 88,394,430 K610E probably benign Het
Sppl2a A G 2: 126,920,417 probably benign Het
Stk-ps2 T A 1: 46,029,691 noncoding transcript Het
Sult3a1 T C 10: 33,864,014 M23T probably benign Het
Syt5 A G 7: 4,545,683 L50P possibly damaging Het
Tacr1 A G 6: 82,555,031 I303V possibly damaging Het
Trip12 C A 1: 84,768,597 V487F probably damaging Het
Vcp A G 4: 42,983,011 S612P possibly damaging Het
Vmn1r47 A G 6: 90,022,806 I307V probably null Het
Vmn1r83 T G 7: 12,321,992 D46A probably damaging Het
Vmn2r118 G T 17: 55,610,772 Q247K probably benign Het
Vmn2r94 C T 17: 18,257,165 C328Y probably damaging Het
Vps13b T A 15: 35,371,999 Y13* probably null Het
Vps13d C T 4: 145,087,184 R3241H probably damaging Het
Wdr5b A G 16: 36,042,470 T320A probably benign Het
Zfp541 A G 7: 16,095,682 probably benign Het
Zfp708 A T 13: 67,070,717 Y314* probably null Het
Other mutations in Zfhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfhx2 APN 14 55066565 missense possibly damaging 0.93
IGL00164:Zfhx2 APN 14 55065026 missense possibly damaging 0.73
IGL00235:Zfhx2 APN 14 55063257 missense probably benign 0.11
IGL00925:Zfhx2 APN 14 55073061 missense probably benign 0.06
IGL01025:Zfhx2 APN 14 55064260 missense probably damaging 1.00
IGL01061:Zfhx2 APN 14 55073882 missense possibly damaging 0.96
IGL01486:Zfhx2 APN 14 55067090 missense probably damaging 1.00
IGL01875:Zfhx2 APN 14 55063915 missense unknown
IGL01990:Zfhx2 APN 14 55073590 missense probably damaging 0.99
IGL02097:Zfhx2 APN 14 55062894 missense probably damaging 1.00
IGL02269:Zfhx2 APN 14 55071936 missense probably benign 0.00
IGL02488:Zfhx2 APN 14 55065103 missense possibly damaging 0.72
IGL02624:Zfhx2 APN 14 55066628 missense probably benign 0.06
IGL03087:Zfhx2 APN 14 55072845 missense possibly damaging 0.85
PIT4403001:Zfhx2 UTSW 14 55074980 missense probably benign
R0148:Zfhx2 UTSW 14 55072897 missense possibly damaging 0.86
R0323:Zfhx2 UTSW 14 55065979 missense possibly damaging 0.73
R0328:Zfhx2 UTSW 14 55071988 missense probably benign
R0348:Zfhx2 UTSW 14 55063508 missense probably damaging 0.99
R0442:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R0533:Zfhx2 UTSW 14 55064090 missense probably benign 0.23
R0561:Zfhx2 UTSW 14 55065889 missense probably benign 0.01
R0659:Zfhx2 UTSW 14 55073801 missense possibly damaging 0.73
R0675:Zfhx2 UTSW 14 55063163 missense probably damaging 0.99
R1301:Zfhx2 UTSW 14 55063397 missense probably benign 0.32
R1563:Zfhx2 UTSW 14 55065088 missense probably benign 0.33
R1607:Zfhx2 UTSW 14 55062985 missense probably damaging 1.00
R1694:Zfhx2 UTSW 14 55073944 missense possibly damaging 0.91
R1710:Zfhx2 UTSW 14 55065998 missense possibly damaging 0.70
R1773:Zfhx2 UTSW 14 55072891 missense possibly damaging 0.53
R1879:Zfhx2 UTSW 14 55065617 missense probably benign 0.32
R1879:Zfhx2 UTSW 14 55072749 missense possibly damaging 0.96
R1933:Zfhx2 UTSW 14 55075238 start gained probably benign
R1944:Zfhx2 UTSW 14 55074732 missense probably benign 0.18
R2888:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2889:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2915:Zfhx2 UTSW 14 55064557 missense probably damaging 0.98
R3971:Zfhx2 UTSW 14 55074475 missense probably benign 0.33
R4082:Zfhx2 UTSW 14 55065205 missense probably benign
R4134:Zfhx2 UTSW 14 55065143 missense possibly damaging 0.93
R4231:Zfhx2 UTSW 14 55073534 missense possibly damaging 0.73
R4675:Zfhx2 UTSW 14 55067221 missense probably benign 0.03
R4764:Zfhx2 UTSW 14 55066915 missense possibly damaging 0.96
R4866:Zfhx2 UTSW 14 55065536 missense possibly damaging 0.73
R4940:Zfhx2 UTSW 14 55066434 missense possibly damaging 0.53
R5125:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5178:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5554:Zfhx2 UTSW 14 55064317 missense probably damaging 1.00
R5689:Zfhx2 UTSW 14 55073903 missense possibly damaging 0.53
R5768:Zfhx2 UTSW 14 55074365 missense probably benign
R5792:Zfhx2 UTSW 14 55066846 missense possibly damaging 0.72
R5834:Zfhx2 UTSW 14 55073330 nonsense probably null
R5895:Zfhx2 UTSW 14 55065891 missense probably benign
R5999:Zfhx2 UTSW 14 55074005 missense probably benign
R6025:Zfhx2 UTSW 14 55065208 missense probably benign 0.00
R6106:Zfhx2 UTSW 14 55068310 critical splice acceptor site probably null
R6135:Zfhx2 UTSW 14 55074196 missense possibly damaging 0.85
R6186:Zfhx2 UTSW 14 55063160 missense probably damaging 0.99
R6379:Zfhx2 UTSW 14 55074338 missense probably benign
R6725:Zfhx2 UTSW 14 55064082 nonsense probably null
R7089:Zfhx2 UTSW 14 55065772 missense probably benign 0.33
R7383:Zfhx2 UTSW 14 55068253 missense probably benign 0.00
R7470:Zfhx2 UTSW 14 55066750 missense possibly damaging 0.52
R7606:Zfhx2 UTSW 14 55066663 missense probably benign 0.12
R7607:Zfhx2 UTSW 14 55066231 missense possibly damaging 0.86
R7698:Zfhx2 UTSW 14 55062849 missense probably benign 0.00
R7730:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
X0065:Zfhx2 UTSW 14 55066960 missense probably benign 0.33
Z1088:Zfhx2 UTSW 14 55074180 missense possibly damaging 0.73
Z1177:Zfhx2 UTSW 14 55065920 missense probably benign 0.40
Z1177:Zfhx2 UTSW 14 55066982 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGCACAGATGGTAGCAAATGGAGTC -3'
(R):5'- TTCCAGAATGCCCGCCAGAAAG -3'

Sequencing Primer
(F):5'- TAGCAAATGGAGTCGATGGTG -3'
(R):5'- GCCCGTAAAAATGCCTGTG -3'
Posted On2013-07-11