Incidental Mutation 'R7431:Nin'
ID576494
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Nameninein
Synonyms3110068G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7431 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location70011435-70113717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70078223 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 108 (R108S)
Ref Sequence ENSEMBL: ENSMUSP00000082422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000221275] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: R108S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: R108S

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: R108S

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: R108S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: R108S

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: R108S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: R108S

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220689
AA Change: R108S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000222835
AA Change: R108S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: R108S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,881,837 H10R probably benign Het
4931406P16Rik T C 7: 34,284,794 I135V possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Abcf3 G T 16: 20,558,789 R510L probably benign Het
Abcg4 T A 9: 44,274,700 I625F possibly damaging Het
Adam22 A T 5: 8,092,818 S806T probably damaging Het
Adcy4 T C 14: 55,772,672 I718V probably benign Het
Adgb A T 10: 10,391,955 probably null Het
Aldoart1 T A 4: 72,851,441 K377* probably null Het
Apc2 T A 10: 80,302,183 V100E possibly damaging Het
Asxl3 T G 18: 22,516,953 D666E probably damaging Het
Atg4c A T 4: 99,221,395 I200F possibly damaging Het
Atp1a4 A G 1: 172,250,907 F255L probably benign Het
Bod1l A C 5: 41,813,120 probably null Het
Cacna2d4 A T 6: 119,244,276 T250S probably damaging Het
Ccdc114 T G 7: 45,929,246 L81R probably damaging Het
Ccng1 G A 11: 40,753,918 R51W possibly damaging Het
Chd6 T C 2: 161,026,328 E366G possibly damaging Het
Clca4b A T 3: 144,911,133 S919T probably benign Het
Col5a3 T C 9: 20,770,835 *1740W probably null Het
Col6a5 A T 9: 105,928,269 I1146K unknown Het
Cpxm1 T C 2: 130,394,046 T399A probably benign Het
Cpz T C 5: 35,511,142 T375A probably benign Het
Cyp2b13 T A 7: 26,061,551 V11D probably damaging Het
Cyp39a1 A G 17: 43,683,015 T189A probably benign Het
Desi2 C T 1: 178,256,441 Q52* probably null Het
Dhx15 A G 5: 52,162,611 V418A probably damaging Het
Dnah3 T A 7: 120,051,744 M978L probably damaging Het
Dpagt1 T A 9: 44,326,087 C17* probably null Het
Dph5 A T 3: 115,892,732 K52N possibly damaging Het
Dpp4 G T 2: 62,352,238 N566K probably benign Het
Elavl4 T C 4: 110,226,633 Y94C probably damaging Het
Fat2 G A 11: 55,309,101 T1049I probably damaging Het
Fat4 T A 3: 39,009,157 Y4421N possibly damaging Het
Fcrls C A 3: 87,258,926 A181S probably damaging Het
Glg1 G T 8: 111,160,754 N456K unknown Het
Gm10228 A G 16: 89,041,213 S68P unknown Het
Golga4 G A 9: 118,559,731 E1974K probably damaging Het
Heatr9 G T 11: 83,519,268 P49Q probably damaging Het
Hmgxb3 A T 18: 61,147,445 V662D probably damaging Het
Hs3st4 T C 7: 123,983,290 L37P probably damaging Het
Ifi205 A T 1: 174,028,377 M29K probably benign Het
Igkv1-35 C T 6: 70,011,004 V103M probably damaging Het
Klf13 T A 7: 63,891,756 K208* probably null Het
Klhl36 A G 8: 119,870,382 N274S probably benign Het
Mosmo T A 7: 120,730,650 L165I probably benign Het
Mtcl1 G A 17: 66,342,906 Q1855* probably null Het
Muc16 A G 9: 18,607,993 V208A Het
Olfr159 T C 4: 43,770,882 N43S probably damaging Het
Polr1a G A 6: 71,926,659 V319I probably benign Het
Pramel7 A G 2: 87,489,938 V337A possibly damaging Het
Prkar2b A T 12: 31,963,151 probably null Het
R3hdm2 T A 10: 127,458,147 M170K probably benign Het
Rbm26 A G 14: 105,117,092 I919T possibly damaging Het
Rimkla A G 4: 119,477,811 M125T probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Sbf2 G T 7: 110,351,750 D1163E probably damaging Het
Scgb2b24 T C 7: 33,739,249 I13V probably benign Het
Scin G A 12: 40,133,922 H63Y probably damaging Het
Sele A G 1: 164,051,620 T275A probably damaging Het
Slc22a15 T A 3: 101,897,940 T144S probably benign Het
Slc8a1 T A 17: 81,441,663 K650I probably benign Het
Slc9c1 G T 16: 45,593,484 V992F probably damaging Het
Spag16 A T 1: 69,923,872 T393S unknown Het
Taf15 G A 11: 83,504,953 D495N unknown Het
Tas2r144 T A 6: 42,215,974 I216N probably damaging Het
Tbccd1 G T 16: 22,825,813 P271Q probably benign Het
Tcf4 C A 18: 69,347,178 probably null Het
Thap4 A T 1: 93,750,501 S188T probably benign Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trip11 A G 12: 101,884,019 V1262A possibly damaging Het
Tspan2 T A 3: 102,749,791 W35R probably damaging Het
Usp39 G T 6: 72,336,268 T313N possibly damaging Het
Vmn2r83 T A 10: 79,491,472 L638Q probably damaging Het
Vps29 T C 5: 122,354,478 V2A probably benign Het
Wrap53 A G 11: 69,578,487 F148L possibly damaging Het
Znfx1 T C 2: 167,055,792 Y404C probably damaging Het
Zrsr1 A G 11: 22,973,580 E118G probably benign Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R4912:Nin UTSW 12 70044063 missense probably damaging 1.00
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
R7170:Nin UTSW 12 70044239 missense
R7324:Nin UTSW 12 70043734 missense
R7338:Nin UTSW 12 70044064 missense
R7372:Nin UTSW 12 70056029 missense
R7577:Nin UTSW 12 70062706 missense
R7655:Nin UTSW 12 70042768 missense
R7656:Nin UTSW 12 70042768 missense
R7683:Nin UTSW 12 70078182 missense
R7769:Nin UTSW 12 70043230 missense
R7981:Nin UTSW 12 70042817 missense
R8138:Nin UTSW 12 70042898 missense
R8141:Nin UTSW 12 70030021 missense
Z1176:Nin UTSW 12 70049164 critical splice acceptor site probably null
Z1177:Nin UTSW 12 70044095 missense
Z1177:Nin UTSW 12 70054426 missense
Predicted Primers PCR Primer
(F):5'- ACTTGTGTCTCATGCTACCCAG -3'
(R):5'- ACCCAAGGACTCATATGCGC -3'

Sequencing Primer
(F):5'- TCATGCTACCCAGGGCTCATG -3'
(R):5'- AGGACTCATATGCGCCCACG -3'
Posted On2019-10-07