Incidental Mutation 'R7431:Slc9c1'
ID576501
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R7431 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45593484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 992 (V992F)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: V992F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: V992F

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,881,837 H10R probably benign Het
4931406P16Rik T C 7: 34,284,794 I135V possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Abcf3 G T 16: 20,558,789 R510L probably benign Het
Abcg4 T A 9: 44,274,700 I625F possibly damaging Het
Adam22 A T 5: 8,092,818 S806T probably damaging Het
Adcy4 T C 14: 55,772,672 I718V probably benign Het
Adgb A T 10: 10,391,955 probably null Het
Aldoart1 T A 4: 72,851,441 K377* probably null Het
Apc2 T A 10: 80,302,183 V100E possibly damaging Het
Asxl3 T G 18: 22,516,953 D666E probably damaging Het
Atg4c A T 4: 99,221,395 I200F possibly damaging Het
Atp1a4 A G 1: 172,250,907 F255L probably benign Het
Bod1l A C 5: 41,813,120 probably null Het
Cacna2d4 A T 6: 119,244,276 T250S probably damaging Het
Ccdc114 T G 7: 45,929,246 L81R probably damaging Het
Ccng1 G A 11: 40,753,918 R51W possibly damaging Het
Chd6 T C 2: 161,026,328 E366G possibly damaging Het
Clca4b A T 3: 144,911,133 S919T probably benign Het
Col5a3 T C 9: 20,770,835 *1740W probably null Het
Col6a5 A T 9: 105,928,269 I1146K unknown Het
Cpxm1 T C 2: 130,394,046 T399A probably benign Het
Cpz T C 5: 35,511,142 T375A probably benign Het
Cyp2b13 T A 7: 26,061,551 V11D probably damaging Het
Cyp39a1 A G 17: 43,683,015 T189A probably benign Het
Desi2 C T 1: 178,256,441 Q52* probably null Het
Dhx15 A G 5: 52,162,611 V418A probably damaging Het
Dnah3 T A 7: 120,051,744 M978L probably damaging Het
Dpagt1 T A 9: 44,326,087 C17* probably null Het
Dph5 A T 3: 115,892,732 K52N possibly damaging Het
Dpp4 G T 2: 62,352,238 N566K probably benign Het
Elavl4 T C 4: 110,226,633 Y94C probably damaging Het
Fat2 G A 11: 55,309,101 T1049I probably damaging Het
Fat4 T A 3: 39,009,157 Y4421N possibly damaging Het
Fcrls C A 3: 87,258,926 A181S probably damaging Het
Glg1 G T 8: 111,160,754 N456K unknown Het
Gm10228 A G 16: 89,041,213 S68P unknown Het
Golga4 G A 9: 118,559,731 E1974K probably damaging Het
Heatr9 G T 11: 83,519,268 P49Q probably damaging Het
Hmgxb3 A T 18: 61,147,445 V662D probably damaging Het
Hs3st4 T C 7: 123,983,290 L37P probably damaging Het
Ifi205 A T 1: 174,028,377 M29K probably benign Het
Igkv1-35 C T 6: 70,011,004 V103M probably damaging Het
Klf13 T A 7: 63,891,756 K208* probably null Het
Klhl36 A G 8: 119,870,382 N274S probably benign Het
Mosmo T A 7: 120,730,650 L165I probably benign Het
Mtcl1 G A 17: 66,342,906 Q1855* probably null Het
Muc16 A G 9: 18,607,993 V208A Het
Nin T G 12: 70,078,223 R108S Het
Olfr159 T C 4: 43,770,882 N43S probably damaging Het
Polr1a G A 6: 71,926,659 V319I probably benign Het
Pramel7 A G 2: 87,489,938 V337A possibly damaging Het
Prkar2b A T 12: 31,963,151 probably null Het
R3hdm2 T A 10: 127,458,147 M170K probably benign Het
Rbm26 A G 14: 105,117,092 I919T possibly damaging Het
Rimkla A G 4: 119,477,811 M125T probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Sbf2 G T 7: 110,351,750 D1163E probably damaging Het
Scgb2b24 T C 7: 33,739,249 I13V probably benign Het
Scin G A 12: 40,133,922 H63Y probably damaging Het
Sele A G 1: 164,051,620 T275A probably damaging Het
Slc22a15 T A 3: 101,897,940 T144S probably benign Het
Slc8a1 T A 17: 81,441,663 K650I probably benign Het
Spag16 A T 1: 69,923,872 T393S unknown Het
Taf15 G A 11: 83,504,953 D495N unknown Het
Tas2r144 T A 6: 42,215,974 I216N probably damaging Het
Tbccd1 G T 16: 22,825,813 P271Q probably benign Het
Tcf4 C A 18: 69,347,178 probably null Het
Thap4 A T 1: 93,750,501 S188T probably benign Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trip11 A G 12: 101,884,019 V1262A possibly damaging Het
Tspan2 T A 3: 102,749,791 W35R probably damaging Het
Usp39 G T 6: 72,336,268 T313N possibly damaging Het
Vmn2r83 T A 10: 79,491,472 L638Q probably damaging Het
Vps29 T C 5: 122,354,478 V2A probably benign Het
Wrap53 A G 11: 69,578,487 F148L possibly damaging Het
Znfx1 T C 2: 167,055,792 Y404C probably damaging Het
Zrsr1 A G 11: 22,973,580 E118G probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGTGACATAAATTAACCAGCG -3'
(R):5'- TGTGGTAGGCACACTTTTGAAAC -3'

Sequencing Primer
(F):5'- GTGACATAAATTAACCAGCGTATGTG -3'
(R):5'- AGCTAGCCTCTGAATCCAGTGATG -3'
Posted On2019-10-07