Incidental Mutation 'R7432:Rcor3'
ID576514
Institutional Source Beutler Lab
Gene Symbol Rcor3
Ensembl Gene ENSMUSG00000037395
Gene NameREST corepressor 3
SynonymsE130101E15Rik, C730034D20Rik, 4921514E24Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R7432 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location192098546-192138062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 192137876 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 8 (G8V)
Ref Sequence ENSEMBL: ENSMUSP00000106473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073279] [ENSMUST00000110849] [ENSMUST00000192128] [ENSMUST00000192158] [ENSMUST00000192491] [ENSMUST00000192866] [ENSMUST00000193144]
Predicted Effect unknown
Transcript: ENSMUST00000073279
AA Change: G8V
SMART Domains Protein: ENSMUSP00000073004
Gene: ENSMUSG00000037395
AA Change: G8V

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 349 363 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110849
AA Change: G8V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106473
Gene: ENSMUSG00000037395
AA Change: G8V

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192128
AA Change: G8V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141637
Gene: ENSMUSG00000037395
AA Change: G8V

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192158
AA Change: G8V
SMART Domains Protein: ENSMUSP00000141841
Gene: ENSMUSG00000037395
AA Change: G8V

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 98 6.6e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192491
AA Change: G8V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141753
Gene: ENSMUSG00000037395
AA Change: G8V

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192866
AA Change: G8V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142054
Gene: ENSMUSG00000037395
AA Change: G8V

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193144
SMART Domains Protein: ENSMUSP00000142001
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
ELM2 1 54 1.8e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,518,839 I31V probably benign Het
Adamts17 A G 7: 67,051,917 K40E Het
Akr1c14 G A 13: 4,088,952 D312N probably benign Het
Alg6 T C 4: 99,753,058 V398A probably benign Het
Ankmy1 A T 1: 92,896,079 M155K probably benign Het
Arid5b C A 10: 68,118,266 R396L probably damaging Het
Armt1 C A 10: 4,432,706 D12E probably benign Het
Arrb2 T A 11: 70,437,970 N217K probably benign Het
Atg2b A T 12: 105,661,204 L508Q probably damaging Het
Atg2b A T 12: 105,664,698 S323T probably benign Het
Atp1a3 G A 7: 25,005,875 probably benign Het
Atp6v0e T C 17: 26,682,698 V42A probably benign Het
Atp9b A G 18: 80,765,841 V621A Het
Atrnl1 A C 19: 57,755,524 D1186A probably damaging Het
Atxn2l A T 7: 126,493,874 M821K possibly damaging Het
Blnk G A 19: 40,959,857 R123* probably null Het
Bud13 T A 9: 46,287,074 S98T probably benign Het
Ccdc183 T C 2: 25,609,457 M455V probably benign Het
Cd109 A G 9: 78,714,943 Y1405C possibly damaging Het
Cdan1 A T 2: 120,722,755 L989Q probably damaging Het
Clec16a T C 16: 10,688,555 I713T possibly damaging Het
Clta T A 4: 44,032,419 F168L possibly damaging Het
Cnnm1 A T 19: 43,468,271 H583L probably benign Het
Cyp4f18 A G 8: 71,996,062 Y248H probably benign Het
Dsg4 G T 18: 20,446,266 G20* probably null Het
Dusp12 T A 1: 170,879,776 K248* probably null Het
Fam102b C T 3: 109,003,407 A51T probably damaging Het
Fhod3 A G 18: 25,001,909 D359G possibly damaging Het
Frmpd2 C A 14: 33,507,553 F365L probably damaging Het
Gab1 A G 8: 80,788,669 I340T probably benign Het
Gabpa C T 16: 84,857,520 Q362* probably null Het
Gcnt2 A T 13: 40,887,212 probably benign Het
Gm12728 T A 4: 105,794,289 L32Q probably damaging Het
Gpatch4 A G 3: 88,051,696 N35D probably damaging Het
Grid2 G T 6: 64,275,870 V441L possibly damaging Het
H2-M2 A G 17: 37,481,470 probably null Het
Hip1r T C 5: 123,991,766 F180L probably benign Het
Ikbkap C T 4: 56,776,925 G624D probably damaging Het
Il17re T C 6: 113,462,371 F81L probably benign Het
Il3ra T C 14: 14,350,691 V235A possibly damaging Het
Krtap6-2 C T 16: 89,419,873 G69S unknown Het
Lmln T C 16: 33,089,368 L373P probably damaging Het
Lmo7 C A 14: 101,902,115 Q945K probably benign Het
Loxhd1 G T 18: 77,295,851 V149L possibly damaging Het
Lrrc73 T C 17: 46,255,783 probably null Het
Mapkapk5 G A 5: 121,537,171 H112Y possibly damaging Het
Maz A G 7: 127,023,048 V467A probably benign Het
Med13l T G 5: 118,751,938 V1884G probably damaging Het
Nlrp12 A C 7: 3,222,539 N1033K probably benign Het
Nos3 T A 5: 24,367,615 V184E probably damaging Het
Npr2 T C 4: 43,647,155 V737A probably damaging Het
Nsd1 A G 13: 55,213,374 T52A probably benign Het
Obscn C T 11: 59,028,907 R108Q Het
Olfr1093 G T 2: 86,786,221 G164* probably null Het
Olfr1265 A T 2: 90,037,184 K88N probably damaging Het
Olfr1300-ps1 A G 2: 111,692,056 *179W probably null Het
Olfr153 T C 2: 87,532,440 S136P probably damaging Het
Olfr460 C A 6: 40,572,306 R307S probably benign Het
Olfr814 T C 10: 129,873,850 I302M probably benign Het
Ovol2 A G 2: 144,317,872 V116A probably benign Het
Pcdha5 C A 18: 36,962,326 S629R probably benign Het
Pde4dip T A 3: 97,695,092 M2274L probably benign Het
Pdpk1 T C 17: 24,101,669 T185A probably benign Het
Pip5k1a T G 3: 95,074,120 T67P probably benign Het
Plat G T 8: 22,773,651 V189F probably damaging Het
Ppm1a C T 12: 72,784,142 S147L probably damaging Het
Prim1 T A 10: 128,016,016 D52E probably damaging Het
Prkab1 C G 5: 116,024,162 D30H possibly damaging Het
Psma6 A T 12: 55,398,828 probably benign Het
Psmd2 T A 16: 20,654,925 M196K probably damaging Het
Ralgapa2 G T 2: 146,434,856 T488K probably benign Het
Rapgefl1 A G 11: 98,851,114 K635E probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rgs11 G A 17: 26,207,760 V289M probably damaging Het
Scmh1 T C 4: 120,529,156 L631P probably damaging Het
Sema3e T G 5: 14,224,390 D218E probably damaging Het
Sh3rf2 T C 18: 42,054,026 V70A probably damaging Het
Slc12a1 G T 2: 125,206,040 V801L probably benign Het
Slc25a51 C G 4: 45,399,765 A142P possibly damaging Het
Slc41a1 C T 1: 131,830,956 T112I probably damaging Het
Slc44a2 T C 9: 21,343,215 M264T probably benign Het
Snapc1 T A 12: 73,968,294 M134K probably benign Het
Snrk T C 9: 122,157,210 F215S probably damaging Het
Stab2 T C 10: 86,885,683 E1526G probably damaging Het
Tbc1d10a C A 11: 4,213,016 Y260* probably null Het
Tdrd5 A T 1: 156,302,432 L56Q probably damaging Het
Tenm2 T C 11: 36,864,941 T77A probably benign Het
Tmprss11g T G 5: 86,496,507 R159S possibly damaging Het
Traj38 T A 14: 54,180,577 N1K Het
Trove2 T C 1: 143,765,810 I304M probably benign Het
Ttn A G 2: 76,766,287 I20094T possibly damaging Het
Ubr4 T C 4: 139,388,382 L64P probably damaging Het
Utp20 C T 10: 88,798,398 R812Q probably benign Het
Vmn2r57 C A 7: 41,426,724 V455L probably benign Het
Wdcp T C 12: 4,850,246 V34A probably damaging Het
Zfp27 C T 7: 29,895,359 V394I probably benign Het
Zfp512b T C 2: 181,589,856 H177R probably benign Het
Zfp648 T A 1: 154,205,037 M314K possibly damaging Het
Zfp811 T C 17: 32,798,759 I102M possibly damaging Het
Zkscan6 A G 11: 65,814,363 probably null Het
Other mutations in Rcor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Rcor3 APN 1 192127971 unclassified probably benign
IGL01688:Rcor3 APN 1 192123600 missense probably damaging 1.00
IGL01905:Rcor3 APN 1 192101002 missense probably damaging 1.00
R0523:Rcor3 UTSW 1 192130436 missense probably damaging 1.00
R1305:Rcor3 UTSW 1 192116346 missense possibly damaging 0.50
R1847:Rcor3 UTSW 1 192100833 missense possibly damaging 0.83
R1850:Rcor3 UTSW 1 192120111 missense probably benign
R3938:Rcor3 UTSW 1 192101085 missense possibly damaging 0.92
R4403:Rcor3 UTSW 1 192119912 splice site probably null
R4590:Rcor3 UTSW 1 192125917 missense probably damaging 1.00
R4750:Rcor3 UTSW 1 192130449 missense probably damaging 1.00
R5219:Rcor3 UTSW 1 192137513 utr 5 prime probably benign
R5617:Rcor3 UTSW 1 192120130 missense probably benign 0.09
R6059:Rcor3 UTSW 1 192119940 missense probably benign 0.21
R6156:Rcor3 UTSW 1 192127842 unclassified probably benign
R6250:Rcor3 UTSW 1 192100896 missense probably damaging 1.00
R6258:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6260:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6808:Rcor3 UTSW 1 192137882 missense possibly damaging 0.79
R7194:Rcor3 UTSW 1 192125961 missense possibly damaging 0.88
R7387:Rcor3 UTSW 1 192137524 start gained probably benign
R7402:Rcor3 UTSW 1 192127983 missense probably benign 0.00
R7407:Rcor3 UTSW 1 192101672 missense probably benign
R7451:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7452:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7570:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7571:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7572:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7718:Rcor3 UTSW 1 192101721 missense probably benign 0.00
R7729:Rcor3 UTSW 1 192101778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCAGAGACTCTCCAGCC -3'
(R):5'- TCCTTCAGCTGAGACAGGG -3'

Sequencing Primer
(F):5'- CTCTCCAGCCGCGGGAG -3'
(R):5'- TCCCTAGGGCGGAGTGATC -3'
Posted On2019-10-07