Incidental Mutation 'R7432:Pde4dip'
ID576529
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7432 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97695092 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 2274 (M2274L)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
Predicted Effect probably benign
Transcript: ENSMUST00000090750
AA Change: M2274L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: M2274L

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168438
AA Change: M2223L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: M2223L

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,518,839 I31V probably benign Het
Adamts17 A G 7: 67,051,917 K40E Het
Akr1c14 G A 13: 4,088,952 D312N probably benign Het
Alg6 T C 4: 99,753,058 V398A probably benign Het
Ankmy1 A T 1: 92,896,079 M155K probably benign Het
Arid5b C A 10: 68,118,266 R396L probably damaging Het
Armt1 C A 10: 4,432,706 D12E probably benign Het
Arrb2 T A 11: 70,437,970 N217K probably benign Het
Atg2b A T 12: 105,661,204 L508Q probably damaging Het
Atg2b A T 12: 105,664,698 S323T probably benign Het
Atp1a3 G A 7: 25,005,875 probably benign Het
Atp6v0e T C 17: 26,682,698 V42A probably benign Het
Atp9b A G 18: 80,765,841 V621A Het
Atrnl1 A C 19: 57,755,524 D1186A probably damaging Het
Atxn2l A T 7: 126,493,874 M821K possibly damaging Het
Blnk G A 19: 40,959,857 R123* probably null Het
Bud13 T A 9: 46,287,074 S98T probably benign Het
Ccdc183 T C 2: 25,609,457 M455V probably benign Het
Cd109 A G 9: 78,714,943 Y1405C possibly damaging Het
Cdan1 A T 2: 120,722,755 L989Q probably damaging Het
Clec16a T C 16: 10,688,555 I713T possibly damaging Het
Clta T A 4: 44,032,419 F168L possibly damaging Het
Cnnm1 A T 19: 43,468,271 H583L probably benign Het
Cyp4f18 A G 8: 71,996,062 Y248H probably benign Het
Dsg4 G T 18: 20,446,266 G20* probably null Het
Dusp12 T A 1: 170,879,776 K248* probably null Het
Fam102b C T 3: 109,003,407 A51T probably damaging Het
Fhod3 A G 18: 25,001,909 D359G possibly damaging Het
Frmpd2 C A 14: 33,507,553 F365L probably damaging Het
Gab1 A G 8: 80,788,669 I340T probably benign Het
Gabpa C T 16: 84,857,520 Q362* probably null Het
Gcnt2 A T 13: 40,887,212 probably benign Het
Gm12728 T A 4: 105,794,289 L32Q probably damaging Het
Gpatch4 A G 3: 88,051,696 N35D probably damaging Het
Grid2 G T 6: 64,275,870 V441L possibly damaging Het
H2-M2 A G 17: 37,481,470 probably null Het
Hip1r T C 5: 123,991,766 F180L probably benign Het
Ikbkap C T 4: 56,776,925 G624D probably damaging Het
Il17re T C 6: 113,462,371 F81L probably benign Het
Il3ra T C 14: 14,350,691 V235A possibly damaging Het
Krtap6-2 C T 16: 89,419,873 G69S unknown Het
Lmln T C 16: 33,089,368 L373P probably damaging Het
Lmo7 C A 14: 101,902,115 Q945K probably benign Het
Loxhd1 G T 18: 77,295,851 V149L possibly damaging Het
Lrrc73 T C 17: 46,255,783 probably null Het
Mapkapk5 G A 5: 121,537,171 H112Y possibly damaging Het
Maz A G 7: 127,023,048 V467A probably benign Het
Med13l T G 5: 118,751,938 V1884G probably damaging Het
Nlrp12 A C 7: 3,222,539 N1033K probably benign Het
Nos3 T A 5: 24,367,615 V184E probably damaging Het
Npr2 T C 4: 43,647,155 V737A probably damaging Het
Nsd1 A G 13: 55,213,374 T52A probably benign Het
Obscn C T 11: 59,028,907 R108Q Het
Olfr1093 G T 2: 86,786,221 G164* probably null Het
Olfr1265 A T 2: 90,037,184 K88N probably damaging Het
Olfr1300-ps1 A G 2: 111,692,056 *179W probably null Het
Olfr153 T C 2: 87,532,440 S136P probably damaging Het
Olfr460 C A 6: 40,572,306 R307S probably benign Het
Olfr814 T C 10: 129,873,850 I302M probably benign Het
Ovol2 A G 2: 144,317,872 V116A probably benign Het
Pcdha5 C A 18: 36,962,326 S629R probably benign Het
Pdpk1 T C 17: 24,101,669 T185A probably benign Het
Pip5k1a T G 3: 95,074,120 T67P probably benign Het
Plat G T 8: 22,773,651 V189F probably damaging Het
Ppm1a C T 12: 72,784,142 S147L probably damaging Het
Prim1 T A 10: 128,016,016 D52E probably damaging Het
Prkab1 C G 5: 116,024,162 D30H possibly damaging Het
Psma6 A T 12: 55,398,828 probably benign Het
Psmd2 T A 16: 20,654,925 M196K probably damaging Het
Ralgapa2 G T 2: 146,434,856 T488K probably benign Het
Rapgefl1 A G 11: 98,851,114 K635E probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs11 G A 17: 26,207,760 V289M probably damaging Het
Scmh1 T C 4: 120,529,156 L631P probably damaging Het
Sema3e T G 5: 14,224,390 D218E probably damaging Het
Sh3rf2 T C 18: 42,054,026 V70A probably damaging Het
Slc12a1 G T 2: 125,206,040 V801L probably benign Het
Slc25a51 C G 4: 45,399,765 A142P possibly damaging Het
Slc41a1 C T 1: 131,830,956 T112I probably damaging Het
Slc44a2 T C 9: 21,343,215 M264T probably benign Het
Snapc1 T A 12: 73,968,294 M134K probably benign Het
Snrk T C 9: 122,157,210 F215S probably damaging Het
Stab2 T C 10: 86,885,683 E1526G probably damaging Het
Tbc1d10a C A 11: 4,213,016 Y260* probably null Het
Tdrd5 A T 1: 156,302,432 L56Q probably damaging Het
Tenm2 T C 11: 36,864,941 T77A probably benign Het
Tmprss11g T G 5: 86,496,507 R159S possibly damaging Het
Traj38 T A 14: 54,180,577 N1K Het
Trove2 T C 1: 143,765,810 I304M probably benign Het
Ttn A G 2: 76,766,287 I20094T possibly damaging Het
Ubr4 T C 4: 139,388,382 L64P probably damaging Het
Utp20 C T 10: 88,798,398 R812Q probably benign Het
Vmn2r57 C A 7: 41,426,724 V455L probably benign Het
Wdcp T C 12: 4,850,246 V34A probably damaging Het
Zfp27 C T 7: 29,895,359 V394I probably benign Het
Zfp512b T C 2: 181,589,856 H177R probably benign Het
Zfp648 T A 1: 154,205,037 M314K possibly damaging Het
Zfp811 T C 17: 32,798,759 I102M possibly damaging Het
Zkscan6 A G 11: 65,814,363 probably null Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCAGAGTACGAGCGTAAC -3'
(R):5'- GATTATACAGAACACGGAATGCTC -3'

Sequencing Primer
(F):5'- AGCTTCTTGCCCAGGGATG -3'
(R):5'- ACGGAATGCTCTGTGGACTC -3'
Posted On2019-10-07