Incidental Mutation 'R0627:Rac2'
ID57653
Institutional Source Beutler Lab
Gene Symbol Rac2
Ensembl Gene ENSMUSG00000033220
Gene NameRac family small GTPase 2
Synonyms
MMRRC Submission 038816-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0627 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78559167-78572783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78564968 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 115 (T115A)
Ref Sequence ENSEMBL: ENSMUSP00000036384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043214] [ENSMUST00000229394]
Predicted Effect probably damaging
Transcript: ENSMUST00000043214
AA Change: T115A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: T115A

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229394
Predicted Effect unknown
Transcript: ENSMUST00000230952
AA Change: T2A
Meta Mutation Damage Score 0.9533 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,685,889 M70T probably benign Het
Adm2 T A 15: 89,324,305 Y149* probably null Het
Ahi1 G A 10: 20,965,522 R236H probably benign Het
Armcx4 A G X: 134,695,823 N2160S possibly damaging Het
Asns A T 6: 7,675,516 D495E probably benign Het
Bcl9 A G 3: 97,205,473 V1222A probably damaging Het
Cd46 A T 1: 195,092,186 C14S probably benign Het
Cdk11b T A 4: 155,640,772 probably benign Het
Cdkl3 T C 11: 52,011,308 Y115H probably damaging Het
Cep41 C A 6: 30,656,631 C274F probably damaging Het
Ces1a C A 8: 93,042,043 V108F probably benign Het
Clca4b A G 3: 144,928,259 Y132H probably benign Het
Col5a3 T C 9: 20,775,485 E1323G unknown Het
Cttnbp2 A G 6: 18,367,373 *1139Q probably null Het
Cyp2d9 T A 15: 82,455,790 I127N probably damaging Het
Dennd1b A G 1: 139,081,219 Y220C probably damaging Het
Desi2 T C 1: 178,249,352 S141P possibly damaging Het
Dgcr2 A G 16: 17,844,008 S453P probably damaging Het
Dnah3 A G 7: 120,020,915 L1586P probably damaging Het
Dpep3 T C 8: 105,978,731 D129G possibly damaging Het
Eci3 C T 13: 34,948,143 V241I possibly damaging Het
Ecm2 A T 13: 49,521,083 probably benign Het
Emilin3 A G 2: 160,908,176 L551P probably damaging Het
Erap1 A C 13: 74,675,814 probably benign Het
Ern1 T C 11: 106,398,693 D928G probably benign Het
Fam214b G T 4: 43,036,242 P163Q probably damaging Het
Fancc C A 13: 63,317,478 A472S probably damaging Het
Fkbp7 A T 2: 76,672,844 D57E probably damaging Het
Gabbr2 T A 4: 46,681,223 I703F possibly damaging Het
Gabrg3 A T 7: 56,724,595 C408S probably damaging Het
Gm13119 C A 4: 144,362,846 L245I probably benign Het
Gm13757 A G 2: 88,446,219 S240P probably damaging Het
Gm8674 T C 13: 49,899,715 noncoding transcript Het
Gnas G A 2: 174,298,135 probably benign Het
Grhl3 A G 4: 135,552,681 V354A probably benign Het
Gsdme G T 6: 50,229,279 probably benign Het
H2-D1 A G 17: 35,265,922 E253G probably damaging Het
Habp2 A G 19: 56,314,046 T31A probably damaging Het
Ifrd1 A G 12: 40,206,987 probably null Het
Il20 A G 1: 130,909,739 probably benign Het
Isx A T 8: 74,892,700 I160F possibly damaging Het
Itgb2l T G 16: 96,422,911 probably benign Het
Kcnv1 T G 15: 45,112,881 probably benign Het
Kif17 T C 4: 138,288,487 probably null Het
Kirrel3 A C 9: 35,035,174 D743A probably damaging Het
Lmod3 T C 6: 97,248,071 D263G probably damaging Het
Manf A G 9: 106,889,186 L132P probably damaging Het
Mark2 C T 19: 7,281,960 probably null Het
Med10 G A 13: 69,815,601 S107N possibly damaging Het
Med31 A G 11: 72,213,775 probably null Het
Mki67 C A 7: 135,708,258 A155S probably benign Het
Mprip T A 11: 59,769,972 L2193Q probably damaging Het
Mylk A G 16: 35,000,429 N126S probably damaging Het
Myo16 A G 8: 10,439,689 I715V probably benign Het
Myo18b T C 5: 112,798,834 T1591A probably benign Het
Myt1 T A 2: 181,795,689 D64E probably benign Het
Ndufa10 A T 1: 92,469,896 Y61N probably damaging Het
Nob1 A G 8: 107,416,224 F275S probably damaging Het
Nop2 T C 6: 125,139,704 V333A possibly damaging Het
Ogdh T A 11: 6,347,216 V545D possibly damaging Het
Olfr1101 T C 2: 86,989,014 N54S probably benign Het
Olfr1461 A G 19: 13,165,250 T79A probably benign Het
Olfr213 T A 6: 116,540,988 N178K possibly damaging Het
Olfr364-ps1 T G 2: 37,146,330 N39K probably damaging Het
Olfr430 G T 1: 174,070,077 V260F probably damaging Het
Olfr826 A G 10: 130,180,688 F64S probably damaging Het
Pcdhb1 T C 18: 37,265,721 F242L probably damaging Het
Pkd2l2 A G 18: 34,425,102 Y278C probably damaging Het
Plxdc1 T A 11: 97,932,204 probably null Het
Ppp2r5b A G 19: 6,232,634 probably benign Het
Prelid2 T A 18: 41,937,652 T39S possibly damaging Het
Prkd1 A T 12: 50,490,041 F87I probably benign Het
Prl3d3 C T 13: 27,156,847 T4I probably damaging Het
Proser3 T A 7: 30,540,783 T299S probably benign Het
Ptprc G T 1: 138,068,320 H1095N probably damaging Het
Rab11fip5 G T 6: 85,348,051 P425T probably benign Het
Rtl9 C A X: 143,101,275 T561K possibly damaging Het
Runx2 T C 17: 44,658,505 probably benign Het
Rxfp1 C T 3: 79,648,211 V613I probably benign Het
Scn9a T C 2: 66,537,377 K656R probably benign Het
Sec31b A G 19: 44,525,607 S406P probably benign Het
Sept5 T C 16: 18,625,365 D44G possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35c2 T C 2: 165,282,136 T94A possibly damaging Het
Slc8a3 T A 12: 81,314,842 D401V probably damaging Het
Slitrk1 A T 14: 108,912,239 C347S probably damaging Het
Smg1 G T 7: 118,167,861 probably benign Het
Snx14 T C 9: 88,394,430 K610E probably benign Het
Sppl2a A G 2: 126,920,417 probably benign Het
Stk-ps2 T A 1: 46,029,691 noncoding transcript Het
Sult3a1 T C 10: 33,864,014 M23T probably benign Het
Syt5 A G 7: 4,545,683 L50P possibly damaging Het
Tacr1 A G 6: 82,555,031 I303V possibly damaging Het
Trip12 C A 1: 84,768,597 V487F probably damaging Het
Vcp A G 4: 42,983,011 S612P possibly damaging Het
Vmn1r47 A G 6: 90,022,806 I307V probably null Het
Vmn1r83 T G 7: 12,321,992 D46A probably damaging Het
Vmn2r118 G T 17: 55,610,772 Q247K probably benign Het
Vmn2r94 C T 17: 18,257,165 C328Y probably damaging Het
Vps13b T A 15: 35,371,999 Y13* probably null Het
Vps13d C T 4: 145,087,184 R3241H probably damaging Het
Wdr5b A G 16: 36,042,470 T320A probably benign Het
Zfhx2 A T 14: 55,065,327 D1733E probably benign Het
Zfp541 A G 7: 16,095,682 probably benign Het
Zfp708 A T 13: 67,070,717 Y314* probably null Het
Other mutations in Rac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense possibly damaging 0.79
Big_bend UTSW 15 78565945 missense possibly damaging 0.95
bingo UTSW 15 78564968 missense probably damaging 1.00
Lamb UTSW 15 78564934 missense possibly damaging 0.68
Potter UTSW 15 78570743 nonsense probably null
Potter2 UTSW 15 78565454 missense probably damaging 0.97
wheel UTSW 15 78566006 missense probably benign 0.29
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R2349:Rac2 UTSW 15 78565475 missense possibly damaging 0.51
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5051:Rac2 UTSW 15 78564934 missense possibly damaging 0.68
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
R7384:Rac2 UTSW 15 78561931 nonsense probably null
R8482:Rac2 UTSW 15 78566006 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGACCAAGTCATTTTACCCAGGCAC -3'
(R):5'- AGGGTCACTAGTACCACACAGGAC -3'

Sequencing Primer
(F):5'- tgacagagaaacacaggcatag -3'
(R):5'- ACAGTGAGGGTTCCTCCTG -3'
Posted On2013-07-11