Incidental Mutation 'R7432:Vmn2r57'
ID 576552
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Name vomeronasal 2, receptor 57
Synonyms EG269902
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R7432 (G1)
Quality Score 196.009
Status Not validated
Chromosome 7
Chromosomal Location 41399732-41448641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 41426724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 455 (V455L)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
AlphaFold L7N269
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000165029
AA Change: V455L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: V455L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,518,839 I31V probably benign Het
Adamts17 A G 7: 67,051,917 K40E Het
Akr1c14 G A 13: 4,088,952 D312N probably benign Het
Alg6 T C 4: 99,753,058 V398A probably benign Het
Ankmy1 A T 1: 92,896,079 M155K probably benign Het
Arid5b C A 10: 68,118,266 R396L probably damaging Het
Armt1 C A 10: 4,432,706 D12E probably benign Het
Arrb2 T A 11: 70,437,970 N217K probably benign Het
Atg2b A T 12: 105,661,204 L508Q probably damaging Het
Atg2b A T 12: 105,664,698 S323T probably benign Het
Atp1a3 G A 7: 25,005,875 probably benign Het
Atp6v0e T C 17: 26,682,698 V42A probably benign Het
Atp9b A G 18: 80,765,841 V621A Het
Atrnl1 A C 19: 57,755,524 D1186A probably damaging Het
Atxn2l A T 7: 126,493,874 M821K possibly damaging Het
Blnk G A 19: 40,959,857 R123* probably null Het
Bud13 T A 9: 46,287,074 S98T probably benign Het
Ccdc183 T C 2: 25,609,457 M455V probably benign Het
Cd109 A G 9: 78,714,943 Y1405C possibly damaging Het
Cdan1 A T 2: 120,722,755 L989Q probably damaging Het
Clec16a T C 16: 10,688,555 I713T possibly damaging Het
Clta T A 4: 44,032,419 F168L possibly damaging Het
Cnnm1 A T 19: 43,468,271 H583L probably benign Het
Cyp4f18 A G 8: 71,996,062 Y248H probably benign Het
Dsg4 G T 18: 20,446,266 G20* probably null Het
Dusp12 T A 1: 170,879,776 K248* probably null Het
Fam102b C T 3: 109,003,407 A51T probably damaging Het
Fhod3 A G 18: 25,001,909 D359G possibly damaging Het
Frmpd2 C A 14: 33,507,553 F365L probably damaging Het
Gab1 A G 8: 80,788,669 I340T probably benign Het
Gabpa C T 16: 84,857,520 Q362* probably null Het
Gcnt2 A T 13: 40,887,212 probably benign Het
Gm12728 T A 4: 105,794,289 L32Q probably damaging Het
Gpatch4 A G 3: 88,051,696 N35D probably damaging Het
Grid2 G T 6: 64,275,870 V441L possibly damaging Het
H2-M2 A G 17: 37,481,470 probably null Het
Hip1r T C 5: 123,991,766 F180L probably benign Het
Ikbkap C T 4: 56,776,925 G624D probably damaging Het
Il17re T C 6: 113,462,371 F81L probably benign Het
Il3ra T C 14: 14,350,691 V235A possibly damaging Het
Krtap6-2 C T 16: 89,419,873 G69S unknown Het
Lmln T C 16: 33,089,368 L373P probably damaging Het
Lmo7 C A 14: 101,902,115 Q945K probably benign Het
Loxhd1 G T 18: 77,295,851 V149L possibly damaging Het
Lrrc73 T C 17: 46,255,783 probably null Het
Mapkapk5 G A 5: 121,537,171 H112Y possibly damaging Het
Maz A G 7: 127,023,048 V467A probably benign Het
Med13l T G 5: 118,751,938 V1884G probably damaging Het
Nlrp12 A C 7: 3,222,539 N1033K probably benign Het
Nos3 T A 5: 24,367,615 V184E probably damaging Het
Npr2 T C 4: 43,647,155 V737A probably damaging Het
Nsd1 A G 13: 55,213,374 T52A probably benign Het
Obscn C T 11: 59,028,907 R108Q Het
Olfr1093 G T 2: 86,786,221 G164* probably null Het
Olfr1265 A T 2: 90,037,184 K88N probably damaging Het
Olfr1300-ps1 A G 2: 111,692,056 *179W probably null Het
Olfr153 T C 2: 87,532,440 S136P probably damaging Het
Olfr460 C A 6: 40,572,306 R307S probably benign Het
Olfr814 T C 10: 129,873,850 I302M probably benign Het
Ovol2 A G 2: 144,317,872 V116A probably benign Het
Pcdha5 C A 18: 36,962,326 S629R probably benign Het
Pde4dip T A 3: 97,695,092 M2274L probably benign Het
Pdpk1 T C 17: 24,101,669 T185A probably benign Het
Pip5k1a T G 3: 95,074,120 T67P probably benign Het
Plat G T 8: 22,773,651 V189F probably damaging Het
Ppm1a C T 12: 72,784,142 S147L probably damaging Het
Prim1 T A 10: 128,016,016 D52E probably damaging Het
Prkab1 C G 5: 116,024,162 D30H possibly damaging Het
Psma6 A T 12: 55,398,828 probably benign Het
Psmd2 T A 16: 20,654,925 M196K probably damaging Het
Ralgapa2 G T 2: 146,434,856 T488K probably benign Het
Rapgefl1 A G 11: 98,851,114 K635E probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs11 G A 17: 26,207,760 V289M probably damaging Het
Scmh1 T C 4: 120,529,156 L631P probably damaging Het
Sema3e T G 5: 14,224,390 D218E probably damaging Het
Sh3rf2 T C 18: 42,054,026 V70A probably damaging Het
Slc12a1 G T 2: 125,206,040 V801L probably benign Het
Slc25a51 C G 4: 45,399,765 A142P possibly damaging Het
Slc41a1 C T 1: 131,830,956 T112I probably damaging Het
Slc44a2 T C 9: 21,343,215 M264T probably benign Het
Snapc1 T A 12: 73,968,294 M134K probably benign Het
Snrk T C 9: 122,157,210 F215S probably damaging Het
Stab2 T C 10: 86,885,683 E1526G probably damaging Het
Tbc1d10a C A 11: 4,213,016 Y260* probably null Het
Tdrd5 A T 1: 156,302,432 L56Q probably damaging Het
Tenm2 T C 11: 36,864,941 T77A probably benign Het
Tmprss11g T G 5: 86,496,507 R159S possibly damaging Het
Traj38 T A 14: 54,180,577 N1K Het
Trove2 T C 1: 143,765,810 I304M probably benign Het
Ttn A G 2: 76,766,287 I20094T possibly damaging Het
Ubr4 T C 4: 139,388,382 L64P probably damaging Het
Utp20 C T 10: 88,798,398 R812Q probably benign Het
Wdcp T C 12: 4,850,246 V34A probably damaging Het
Zfp27 C T 7: 29,895,359 V394I probably benign Het
Zfp512b T C 2: 181,589,856 H177R probably benign Het
Zfp648 T A 1: 154,205,037 M314K possibly damaging Het
Zfp811 T C 17: 32,798,759 I102M possibly damaging Het
Zkscan6 A G 11: 65,814,363 probably null Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41428785 missense probably benign
IGL01108:Vmn2r57 APN 7 41427584 missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41425043 missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41399946 missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41400195 missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41400450 missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41428226 missense probably benign
IGL02801:Vmn2r57 APN 7 41448632 missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41428074 missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41399741 missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41400652 missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41399733 splice site probably null
R0305:Vmn2r57 UTSW 7 41427543 missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41428801 missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41427804 missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41428211 missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41427830 missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41400124 missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41400643 missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41428107 missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41448577 missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41428825 critical splice acceptor site probably null
R2242:Vmn2r57 UTSW 7 41428074 missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41400195 missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41428130 missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41428239 missense probably benign
R4423:Vmn2r57 UTSW 7 41426640 missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41400468 missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41400495 missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41428662 missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41426550 critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41400240 missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41427939 missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41399974 missense probably damaging 0.99
R5745:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41448472 missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41428690 missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41399860 missense probably benign
R6381:Vmn2r57 UTSW 7 41428818 missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41428665 missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41399794 missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41400286 missense probably benign 0.00
R7633:Vmn2r57 UTSW 7 41425089 missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41425015 nonsense probably null
R8025:Vmn2r57 UTSW 7 41426759 missense probably benign 0.00
R8332:Vmn2r57 UTSW 7 41400253 missense probably benign 0.01
R8345:Vmn2r57 UTSW 7 41427544 missense possibly damaging 0.81
R8360:Vmn2r57 UTSW 7 41400216 missense probably damaging 1.00
R8738:Vmn2r57 UTSW 7 41427596 missense probably benign 0.00
R8758:Vmn2r57 UTSW 7 41428739 missense probably damaging 1.00
R8955:Vmn2r57 UTSW 7 41400147 missense possibly damaging 0.64
R8985:Vmn2r57 UTSW 7 41399835 missense probably benign
R9108:Vmn2r57 UTSW 7 41428768 missense possibly damaging 0.87
R9160:Vmn2r57 UTSW 7 41426735 missense possibly damaging 0.48
R9354:Vmn2r57 UTSW 7 41400239 missense probably benign 0.01
X0026:Vmn2r57 UTSW 7 41428125 missense probably benign 0.03
X0026:Vmn2r57 UTSW 7 41428561 missense possibly damaging 0.91
X0065:Vmn2r57 UTSW 7 41427971 missense probably benign 0.09
Z1176:Vmn2r57 UTSW 7 41400498 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAAACTGTGTCGGCCATTG -3'
(R):5'- ACAGGTGTGGCTAGCAGTAC -3'

Sequencing Primer
(F):5'- AACTGTGTCGGCCATTGTATCATTTC -3'
(R):5'- GGAACTGAATCCACATAACATGTTG -3'
Posted On 2019-10-07