Incidental Mutation 'R7432:Cd109'
ID 576561
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene Name CD109 antigen
Synonyms Gov platelet alloantigens, 9930012E15Rik
MMRRC Submission 045510-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7432 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 78522828-78623535 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78622225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1405 (Y1405C)
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
AlphaFold Q8R422
Predicted Effect possibly damaging
Transcript: ENSMUST00000093812
AA Change: Y1405C

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186
AA Change: Y1405C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,468,839 (GRCm39) I31V probably benign Het
Adamts17 A G 7: 66,701,665 (GRCm39) K40E Het
Akr1c14 G A 13: 4,138,952 (GRCm39) D312N probably benign Het
Alg6 T C 4: 99,641,295 (GRCm39) V398A probably benign Het
Ankmy1 A T 1: 92,823,801 (GRCm39) M155K probably benign Het
Arid5b C A 10: 67,954,096 (GRCm39) R396L probably damaging Het
Armt1 C A 10: 4,382,706 (GRCm39) D12E probably benign Het
Arrb2 T A 11: 70,328,796 (GRCm39) N217K probably benign Het
Atg2b A T 12: 105,627,463 (GRCm39) L508Q probably damaging Het
Atg2b A T 12: 105,630,957 (GRCm39) S323T probably benign Het
Atp1a3 G A 7: 24,705,300 (GRCm39) probably benign Het
Atp6v0e T C 17: 26,901,672 (GRCm39) V42A probably benign Het
Atp9b A G 18: 80,809,056 (GRCm39) V621A Het
Atrnl1 A C 19: 57,743,956 (GRCm39) D1186A probably damaging Het
Atxn2l A T 7: 126,093,046 (GRCm39) M821K possibly damaging Het
Blnk G A 19: 40,948,301 (GRCm39) R123* probably null Het
Bud13 T A 9: 46,198,372 (GRCm39) S98T probably benign Het
Ccdc183 T C 2: 25,499,469 (GRCm39) M455V probably benign Het
Cdan1 A T 2: 120,553,236 (GRCm39) L989Q probably damaging Het
Clec16a T C 16: 10,506,419 (GRCm39) I713T possibly damaging Het
Clta T A 4: 44,032,419 (GRCm39) F168L possibly damaging Het
Cnnm1 A T 19: 43,456,710 (GRCm39) H583L probably benign Het
Cyp4f18 A G 8: 72,749,906 (GRCm39) Y248H probably benign Het
Dsg4 G T 18: 20,579,323 (GRCm39) G20* probably null Het
Dusp12 T A 1: 170,707,345 (GRCm39) K248* probably null Het
Eeig2 C T 3: 108,910,723 (GRCm39) A51T probably damaging Het
Elp1 C T 4: 56,776,925 (GRCm39) G624D probably damaging Het
Fhod3 A G 18: 25,134,966 (GRCm39) D359G possibly damaging Het
Frmpd2 C A 14: 33,229,510 (GRCm39) F365L probably damaging Het
Gab1 A G 8: 81,515,298 (GRCm39) I340T probably benign Het
Gabpa C T 16: 84,654,408 (GRCm39) Q362* probably null Het
Gcnt2 A T 13: 41,040,688 (GRCm39) probably benign Het
Gm12728 T A 4: 105,651,486 (GRCm39) L32Q probably damaging Het
Gpatch4 A G 3: 87,959,003 (GRCm39) N35D probably damaging Het
Grid2 G T 6: 64,252,854 (GRCm39) V441L possibly damaging Het
H2-M2 A G 17: 37,792,361 (GRCm39) probably null Het
Hip1r T C 5: 124,129,829 (GRCm39) F180L probably benign Het
Il17re T C 6: 113,439,332 (GRCm39) F81L probably benign Het
Il3ra T C 14: 14,350,691 (GRCm38) V235A possibly damaging Het
Krtap6-2 C T 16: 89,216,761 (GRCm39) G69S unknown Het
Lmln T C 16: 32,909,738 (GRCm39) L373P probably damaging Het
Lmo7 C A 14: 102,139,551 (GRCm39) Q945K probably benign Het
Loxhd1 G T 18: 77,383,547 (GRCm39) V149L possibly damaging Het
Lrrc73 T C 17: 46,566,709 (GRCm39) probably null Het
Mapkapk5 G A 5: 121,675,234 (GRCm39) H112Y possibly damaging Het
Maz A G 7: 126,622,220 (GRCm39) V467A probably benign Het
Med13l T G 5: 118,890,003 (GRCm39) V1884G probably damaging Het
Nlrp12 A C 7: 3,271,213 (GRCm39) N1033K probably benign Het
Nos3 T A 5: 24,572,613 (GRCm39) V184E probably damaging Het
Npr2 T C 4: 43,647,155 (GRCm39) V737A probably damaging Het
Nsd1 A G 13: 55,361,187 (GRCm39) T52A probably benign Het
Obscn C T 11: 58,919,733 (GRCm39) R108Q Het
Or4k50-ps1 A G 2: 111,522,401 (GRCm39) *179W probably null Het
Or4x11 A T 2: 89,867,528 (GRCm39) K88N probably damaging Het
Or5t5 G T 2: 86,616,565 (GRCm39) G164* probably null Het
Or5w22 T C 2: 87,362,784 (GRCm39) S136P probably damaging Het
Or6c70 T C 10: 129,709,719 (GRCm39) I302M probably benign Het
Or9a4 C A 6: 40,549,240 (GRCm39) R307S probably benign Het
Ovol2 A G 2: 144,159,792 (GRCm39) V116A probably benign Het
Pcdha5 C A 18: 37,095,379 (GRCm39) S629R probably benign Het
Pde4dip T A 3: 97,602,408 (GRCm39) M2274L probably benign Het
Pdpk1 T C 17: 24,320,643 (GRCm39) T185A probably benign Het
Pip5k1a T G 3: 94,981,431 (GRCm39) T67P probably benign Het
Plat G T 8: 23,263,667 (GRCm39) V189F probably damaging Het
Ppm1a C T 12: 72,830,916 (GRCm39) S147L probably damaging Het
Prim1 T A 10: 127,851,885 (GRCm39) D52E probably damaging Het
Prkab1 C G 5: 116,162,221 (GRCm39) D30H possibly damaging Het
Psma6 A T 12: 55,445,613 (GRCm39) probably benign Het
Psmd2 T A 16: 20,473,675 (GRCm39) M196K probably damaging Het
Ralgapa2 G T 2: 146,276,776 (GRCm39) T488K probably benign Het
Rapgefl1 A G 11: 98,741,940 (GRCm39) K635E probably damaging Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs11 G A 17: 26,426,734 (GRCm39) V289M probably damaging Het
Ro60 T C 1: 143,641,548 (GRCm39) I304M probably benign Het
Scmh1 T C 4: 120,386,353 (GRCm39) L631P probably damaging Het
Sema3e T G 5: 14,274,404 (GRCm39) D218E probably damaging Het
Sh3rf2 T C 18: 42,187,091 (GRCm39) V70A probably damaging Het
Slc12a1 G T 2: 125,047,960 (GRCm39) V801L probably benign Het
Slc25a51 C G 4: 45,399,765 (GRCm39) A142P possibly damaging Het
Slc41a1 C T 1: 131,758,694 (GRCm39) T112I probably damaging Het
Slc44a2 T C 9: 21,254,511 (GRCm39) M264T probably benign Het
Snapc1 T A 12: 74,015,068 (GRCm39) M134K probably benign Het
Snrk T C 9: 121,986,276 (GRCm39) F215S probably damaging Het
Stab2 T C 10: 86,721,547 (GRCm39) E1526G probably damaging Het
Tbc1d10a C A 11: 4,163,016 (GRCm39) Y260* probably null Het
Tdrd5 A T 1: 156,130,002 (GRCm39) L56Q probably damaging Het
Tenm2 T C 11: 36,755,768 (GRCm39) T77A probably benign Het
Tmprss11g T G 5: 86,644,366 (GRCm39) R159S possibly damaging Het
Traj38 T A 14: 54,418,034 (GRCm39) N1K Het
Ttn A G 2: 76,596,631 (GRCm39) I20094T possibly damaging Het
Ubr4 T C 4: 139,115,693 (GRCm39) L64P probably damaging Het
Utp20 C T 10: 88,634,260 (GRCm39) R812Q probably benign Het
Vmn2r57 C A 7: 41,076,148 (GRCm39) V455L probably benign Het
Wdcp T C 12: 4,900,246 (GRCm39) V34A probably damaging Het
Zfp27 C T 7: 29,594,784 (GRCm39) V394I probably benign Het
Zfp512b T C 2: 181,231,649 (GRCm39) H177R probably benign Het
Zfp648 T A 1: 154,080,783 (GRCm39) M314K possibly damaging Het
Zfp811 T C 17: 33,017,733 (GRCm39) I102M possibly damaging Het
Zkscan6 A G 11: 65,705,189 (GRCm39) probably null Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78,524,251 (GRCm39) missense probably damaging 1.00
IGL00465:Cd109 APN 9 78,568,216 (GRCm39) nonsense probably null
IGL00667:Cd109 APN 9 78,592,159 (GRCm39) missense probably damaging 0.99
IGL01432:Cd109 APN 9 78,605,405 (GRCm39) missense probably benign
IGL01795:Cd109 APN 9 78,569,047 (GRCm39) splice site probably benign
IGL02343:Cd109 APN 9 78,596,237 (GRCm39) splice site probably benign
IGL02450:Cd109 APN 9 78,603,132 (GRCm39) missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78,579,271 (GRCm39) splice site probably benign
IGL02738:Cd109 APN 9 78,598,581 (GRCm39) missense probably damaging 1.00
IGL02797:Cd109 APN 9 78,568,995 (GRCm39) missense probably damaging 0.96
IGL03160:Cd109 APN 9 78,568,338 (GRCm39) splice site probably null
IGL03349:Cd109 APN 9 78,543,767 (GRCm39) missense probably benign 0.34
FR4589:Cd109 UTSW 9 78,619,811 (GRCm39) critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78,587,303 (GRCm39) missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0158:Cd109 UTSW 9 78,596,214 (GRCm39) missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78,619,897 (GRCm39) missense probably benign 0.13
R0659:Cd109 UTSW 9 78,587,452 (GRCm39) splice site probably benign
R0709:Cd109 UTSW 9 78,579,260 (GRCm39) missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78,571,612 (GRCm39) missense probably benign 0.04
R0909:Cd109 UTSW 9 78,543,755 (GRCm39) missense probably benign 0.01
R0945:Cd109 UTSW 9 78,596,223 (GRCm39) missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78,579,832 (GRCm39) critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78,561,869 (GRCm39) missense probably damaging 1.00
R1484:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78,612,373 (GRCm39) missense probably benign 0.17
R1773:Cd109 UTSW 9 78,611,006 (GRCm39) missense probably benign 0.21
R1813:Cd109 UTSW 9 78,524,287 (GRCm39) missense probably benign 0.04
R2004:Cd109 UTSW 9 78,611,044 (GRCm39) missense probably benign 0.00
R2083:Cd109 UTSW 9 78,574,575 (GRCm39) missense probably damaging 1.00
R2483:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R2857:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R3713:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78,543,745 (GRCm39) missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78,579,871 (GRCm39) missense probably benign 0.00
R4723:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78,541,959 (GRCm39) critical splice donor site probably null
R5259:Cd109 UTSW 9 78,617,434 (GRCm39) missense probably benign 0.30
R5353:Cd109 UTSW 9 78,617,521 (GRCm39) missense probably damaging 1.00
R5440:Cd109 UTSW 9 78,587,446 (GRCm39) critical splice donor site probably null
R5559:Cd109 UTSW 9 78,568,250 (GRCm39) missense probably benign 0.01
R5701:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78,607,561 (GRCm39) missense probably benign 0.01
R5997:Cd109 UTSW 9 78,612,344 (GRCm39) missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78,605,596 (GRCm39) splice site probably null
R6174:Cd109 UTSW 9 78,572,828 (GRCm39) critical splice donor site probably null
R6410:Cd109 UTSW 9 78,564,798 (GRCm39) missense probably benign 0.01
R6529:Cd109 UTSW 9 78,619,907 (GRCm39) missense probably damaging 1.00
R6655:Cd109 UTSW 9 78,592,220 (GRCm39) missense probably benign 0.44
R6704:Cd109 UTSW 9 78,587,357 (GRCm39) missense probably benign 0.01
R6772:Cd109 UTSW 9 78,588,092 (GRCm39) missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78,622,237 (GRCm39) missense probably benign 0.01
R6903:Cd109 UTSW 9 78,543,885 (GRCm39) missense probably damaging 0.97
R7294:Cd109 UTSW 9 78,619,917 (GRCm39) missense probably damaging 0.97
R7566:Cd109 UTSW 9 78,588,119 (GRCm39) missense probably damaging 1.00
R7767:Cd109 UTSW 9 78,617,441 (GRCm39) missense probably damaging 1.00
R7986:Cd109 UTSW 9 78,596,048 (GRCm39) missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78,571,633 (GRCm39) missense probably benign 0.28
R8225:Cd109 UTSW 9 78,568,972 (GRCm39) missense probably damaging 0.99
R8269:Cd109 UTSW 9 78,572,964 (GRCm39) missense probably benign 0.06
R8479:Cd109 UTSW 9 78,574,628 (GRCm39) nonsense probably null
R8493:Cd109 UTSW 9 78,564,801 (GRCm39) missense probably benign 0.41
R8781:Cd109 UTSW 9 78,543,929 (GRCm39) missense probably damaging 1.00
R8977:Cd109 UTSW 9 78,614,810 (GRCm39) missense probably benign 0.36
R9051:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
R9051:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R9228:Cd109 UTSW 9 78,577,042 (GRCm39) missense possibly damaging 0.93
R9366:Cd109 UTSW 9 78,622,275 (GRCm39) missense probably benign 0.11
R9430:Cd109 UTSW 9 78,574,698 (GRCm39) critical splice donor site probably null
R9572:Cd109 UTSW 9 78,567,588 (GRCm39) missense probably benign 0.16
R9691:Cd109 UTSW 9 78,611,074 (GRCm39) missense possibly damaging 0.94
R9736:Cd109 UTSW 9 78,619,918 (GRCm39) missense probably damaging 1.00
R9749:Cd109 UTSW 9 78,592,166 (GRCm39) missense probably damaging 1.00
R9751:Cd109 UTSW 9 78,605,442 (GRCm39) missense probably damaging 0.99
R9752:Cd109 UTSW 9 78,614,834 (GRCm39) missense probably benign 0.00
R9789:Cd109 UTSW 9 78,541,944 (GRCm39) missense possibly damaging 0.90
R9797:Cd109 UTSW 9 78,579,217 (GRCm39) missense probably benign 0.04
RF002:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78,619,805 (GRCm39) critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF013:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78,619,809 (GRCm39) critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78,619,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78,598,595 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGCACTGCATTTGTTTCTG -3'
(R):5'- AACCGTCAGAGGCAATCATCAG -3'

Sequencing Primer
(F):5'- AGCACTGCATTTGTTTCTGGTAAAG -3'
(R):5'- TCAGAGGCAATCATCAGGTGTAG -3'
Posted On 2019-10-07