Incidental Mutation 'R7432:Arid5b'
ID 576564
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT-rich interaction domain 5B
Synonyms Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt
MMRRC Submission 045510-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7432 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 67928350-68114570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67954096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 396 (R396L)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218532
AA Change: R153L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219238
AA Change: R396L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,468,839 (GRCm39) I31V probably benign Het
Adamts17 A G 7: 66,701,665 (GRCm39) K40E Het
Akr1c14 G A 13: 4,138,952 (GRCm39) D312N probably benign Het
Alg6 T C 4: 99,641,295 (GRCm39) V398A probably benign Het
Ankmy1 A T 1: 92,823,801 (GRCm39) M155K probably benign Het
Armt1 C A 10: 4,382,706 (GRCm39) D12E probably benign Het
Arrb2 T A 11: 70,328,796 (GRCm39) N217K probably benign Het
Atg2b A T 12: 105,627,463 (GRCm39) L508Q probably damaging Het
Atg2b A T 12: 105,630,957 (GRCm39) S323T probably benign Het
Atp1a3 G A 7: 24,705,300 (GRCm39) probably benign Het
Atp6v0e T C 17: 26,901,672 (GRCm39) V42A probably benign Het
Atp9b A G 18: 80,809,056 (GRCm39) V621A Het
Atrnl1 A C 19: 57,743,956 (GRCm39) D1186A probably damaging Het
Atxn2l A T 7: 126,093,046 (GRCm39) M821K possibly damaging Het
Blnk G A 19: 40,948,301 (GRCm39) R123* probably null Het
Bud13 T A 9: 46,198,372 (GRCm39) S98T probably benign Het
Ccdc183 T C 2: 25,499,469 (GRCm39) M455V probably benign Het
Cd109 A G 9: 78,622,225 (GRCm39) Y1405C possibly damaging Het
Cdan1 A T 2: 120,553,236 (GRCm39) L989Q probably damaging Het
Clec16a T C 16: 10,506,419 (GRCm39) I713T possibly damaging Het
Clta T A 4: 44,032,419 (GRCm39) F168L possibly damaging Het
Cnnm1 A T 19: 43,456,710 (GRCm39) H583L probably benign Het
Cyp4f18 A G 8: 72,749,906 (GRCm39) Y248H probably benign Het
Dsg4 G T 18: 20,579,323 (GRCm39) G20* probably null Het
Dusp12 T A 1: 170,707,345 (GRCm39) K248* probably null Het
Eeig2 C T 3: 108,910,723 (GRCm39) A51T probably damaging Het
Elp1 C T 4: 56,776,925 (GRCm39) G624D probably damaging Het
Fhod3 A G 18: 25,134,966 (GRCm39) D359G possibly damaging Het
Frmpd2 C A 14: 33,229,510 (GRCm39) F365L probably damaging Het
Gab1 A G 8: 81,515,298 (GRCm39) I340T probably benign Het
Gabpa C T 16: 84,654,408 (GRCm39) Q362* probably null Het
Gcnt2 A T 13: 41,040,688 (GRCm39) probably benign Het
Gm12728 T A 4: 105,651,486 (GRCm39) L32Q probably damaging Het
Gpatch4 A G 3: 87,959,003 (GRCm39) N35D probably damaging Het
Grid2 G T 6: 64,252,854 (GRCm39) V441L possibly damaging Het
H2-M2 A G 17: 37,792,361 (GRCm39) probably null Het
Hip1r T C 5: 124,129,829 (GRCm39) F180L probably benign Het
Il17re T C 6: 113,439,332 (GRCm39) F81L probably benign Het
Il3ra T C 14: 14,350,691 (GRCm38) V235A possibly damaging Het
Krtap6-2 C T 16: 89,216,761 (GRCm39) G69S unknown Het
Lmln T C 16: 32,909,738 (GRCm39) L373P probably damaging Het
Lmo7 C A 14: 102,139,551 (GRCm39) Q945K probably benign Het
Loxhd1 G T 18: 77,383,547 (GRCm39) V149L possibly damaging Het
Lrrc73 T C 17: 46,566,709 (GRCm39) probably null Het
Mapkapk5 G A 5: 121,675,234 (GRCm39) H112Y possibly damaging Het
Maz A G 7: 126,622,220 (GRCm39) V467A probably benign Het
Med13l T G 5: 118,890,003 (GRCm39) V1884G probably damaging Het
Nlrp12 A C 7: 3,271,213 (GRCm39) N1033K probably benign Het
Nos3 T A 5: 24,572,613 (GRCm39) V184E probably damaging Het
Npr2 T C 4: 43,647,155 (GRCm39) V737A probably damaging Het
Nsd1 A G 13: 55,361,187 (GRCm39) T52A probably benign Het
Obscn C T 11: 58,919,733 (GRCm39) R108Q Het
Or4k50-ps1 A G 2: 111,522,401 (GRCm39) *179W probably null Het
Or4x11 A T 2: 89,867,528 (GRCm39) K88N probably damaging Het
Or5t5 G T 2: 86,616,565 (GRCm39) G164* probably null Het
Or5w22 T C 2: 87,362,784 (GRCm39) S136P probably damaging Het
Or6c70 T C 10: 129,709,719 (GRCm39) I302M probably benign Het
Or9a4 C A 6: 40,549,240 (GRCm39) R307S probably benign Het
Ovol2 A G 2: 144,159,792 (GRCm39) V116A probably benign Het
Pcdha5 C A 18: 37,095,379 (GRCm39) S629R probably benign Het
Pde4dip T A 3: 97,602,408 (GRCm39) M2274L probably benign Het
Pdpk1 T C 17: 24,320,643 (GRCm39) T185A probably benign Het
Pip5k1a T G 3: 94,981,431 (GRCm39) T67P probably benign Het
Plat G T 8: 23,263,667 (GRCm39) V189F probably damaging Het
Ppm1a C T 12: 72,830,916 (GRCm39) S147L probably damaging Het
Prim1 T A 10: 127,851,885 (GRCm39) D52E probably damaging Het
Prkab1 C G 5: 116,162,221 (GRCm39) D30H possibly damaging Het
Psma6 A T 12: 55,445,613 (GRCm39) probably benign Het
Psmd2 T A 16: 20,473,675 (GRCm39) M196K probably damaging Het
Ralgapa2 G T 2: 146,276,776 (GRCm39) T488K probably benign Het
Rapgefl1 A G 11: 98,741,940 (GRCm39) K635E probably damaging Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs11 G A 17: 26,426,734 (GRCm39) V289M probably damaging Het
Ro60 T C 1: 143,641,548 (GRCm39) I304M probably benign Het
Scmh1 T C 4: 120,386,353 (GRCm39) L631P probably damaging Het
Sema3e T G 5: 14,274,404 (GRCm39) D218E probably damaging Het
Sh3rf2 T C 18: 42,187,091 (GRCm39) V70A probably damaging Het
Slc12a1 G T 2: 125,047,960 (GRCm39) V801L probably benign Het
Slc25a51 C G 4: 45,399,765 (GRCm39) A142P possibly damaging Het
Slc41a1 C T 1: 131,758,694 (GRCm39) T112I probably damaging Het
Slc44a2 T C 9: 21,254,511 (GRCm39) M264T probably benign Het
Snapc1 T A 12: 74,015,068 (GRCm39) M134K probably benign Het
Snrk T C 9: 121,986,276 (GRCm39) F215S probably damaging Het
Stab2 T C 10: 86,721,547 (GRCm39) E1526G probably damaging Het
Tbc1d10a C A 11: 4,163,016 (GRCm39) Y260* probably null Het
Tdrd5 A T 1: 156,130,002 (GRCm39) L56Q probably damaging Het
Tenm2 T C 11: 36,755,768 (GRCm39) T77A probably benign Het
Tmprss11g T G 5: 86,644,366 (GRCm39) R159S possibly damaging Het
Traj38 T A 14: 54,418,034 (GRCm39) N1K Het
Ttn A G 2: 76,596,631 (GRCm39) I20094T possibly damaging Het
Ubr4 T C 4: 139,115,693 (GRCm39) L64P probably damaging Het
Utp20 C T 10: 88,634,260 (GRCm39) R812Q probably benign Het
Vmn2r57 C A 7: 41,076,148 (GRCm39) V455L probably benign Het
Wdcp T C 12: 4,900,246 (GRCm39) V34A probably damaging Het
Zfp27 C T 7: 29,594,784 (GRCm39) V394I probably benign Het
Zfp512b T C 2: 181,231,649 (GRCm39) H177R probably benign Het
Zfp648 T A 1: 154,080,783 (GRCm39) M314K possibly damaging Het
Zfp811 T C 17: 33,017,733 (GRCm39) I102M possibly damaging Het
Zkscan6 A G 11: 65,705,189 (GRCm39) probably null Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 67,964,805 (GRCm39) missense probably damaging 0.96
IGL01731:Arid5b APN 10 67,933,439 (GRCm39) missense probably damaging 1.00
IGL02069:Arid5b APN 10 67,933,229 (GRCm39) missense probably damaging 1.00
IGL02161:Arid5b APN 10 67,932,498 (GRCm39) missense probably benign 0.00
IGL02555:Arid5b APN 10 67,937,734 (GRCm39) missense probably benign 0.01
IGL02873:Arid5b APN 10 67,937,780 (GRCm39) missense probably benign 0.06
IGL03119:Arid5b APN 10 68,079,057 (GRCm39) missense probably damaging 1.00
IGL03271:Arid5b APN 10 67,933,287 (GRCm39) missense possibly damaging 0.73
gobi UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
3-1:Arid5b UTSW 10 67,934,419 (GRCm39) missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 67,933,841 (GRCm39) missense probably damaging 0.99
R0108:Arid5b UTSW 10 68,114,559 (GRCm39) utr 5 prime probably benign
R0525:Arid5b UTSW 10 67,933,676 (GRCm39) missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68,021,863 (GRCm39) missense probably damaging 1.00
R0646:Arid5b UTSW 10 67,932,807 (GRCm39) missense probably damaging 1.00
R1066:Arid5b UTSW 10 67,934,186 (GRCm39) missense probably benign 0.04
R1487:Arid5b UTSW 10 67,933,044 (GRCm39) nonsense probably null
R1638:Arid5b UTSW 10 68,113,777 (GRCm39) missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68,021,897 (GRCm39) missense probably damaging 0.99
R2031:Arid5b UTSW 10 68,114,518 (GRCm39) critical splice donor site probably null
R2337:Arid5b UTSW 10 67,933,607 (GRCm39) missense possibly damaging 0.63
R2996:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R2997:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R3547:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R4411:Arid5b UTSW 10 67,932,519 (GRCm39) missense probably damaging 1.00
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R5219:Arid5b UTSW 10 68,113,940 (GRCm39) missense probably benign 0.08
R5341:Arid5b UTSW 10 68,113,957 (GRCm39) missense possibly damaging 0.87
R5434:Arid5b UTSW 10 67,932,719 (GRCm39) missense possibly damaging 0.67
R5757:Arid5b UTSW 10 67,937,909 (GRCm39) missense probably damaging 1.00
R6114:Arid5b UTSW 10 67,933,574 (GRCm39) missense possibly damaging 0.89
R6313:Arid5b UTSW 10 67,933,412 (GRCm39) missense possibly damaging 0.95
R6338:Arid5b UTSW 10 67,934,391 (GRCm39) nonsense probably null
R6525:Arid5b UTSW 10 67,933,496 (GRCm39) missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68,022,042 (GRCm39) nonsense probably null
R7013:Arid5b UTSW 10 67,933,649 (GRCm39) missense probably damaging 1.00
R7099:Arid5b UTSW 10 67,934,009 (GRCm39) missense probably damaging 1.00
R7260:Arid5b UTSW 10 67,933,637 (GRCm39) missense probably damaging 1.00
R7324:Arid5b UTSW 10 67,964,752 (GRCm39) missense probably benign 0.44
R7334:Arid5b UTSW 10 68,079,007 (GRCm39) missense possibly damaging 0.61
R7453:Arid5b UTSW 10 68,078,994 (GRCm39) missense probably benign 0.01
R7649:Arid5b UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
R7659:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7661:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7662:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7663:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7665:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7666:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7759:Arid5b UTSW 10 67,933,632 (GRCm39) missense probably damaging 1.00
R7779:Arid5b UTSW 10 67,932,606 (GRCm39) missense probably damaging 1.00
R7788:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7789:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7875:Arid5b UTSW 10 67,964,771 (GRCm39) missense probably benign 0.02
R8079:Arid5b UTSW 10 67,934,186 (GRCm39) missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68,021,982 (GRCm39) missense probably benign 0.00
R8228:Arid5b UTSW 10 68,114,536 (GRCm39) missense possibly damaging 0.95
R8377:Arid5b UTSW 10 67,933,217 (GRCm39) missense probably damaging 0.96
R8757:Arid5b UTSW 10 67,933,640 (GRCm39) missense probably damaging 1.00
R8910:Arid5b UTSW 10 67,934,108 (GRCm39) missense
R8954:Arid5b UTSW 10 67,937,810 (GRCm39) missense possibly damaging 0.88
R9234:Arid5b UTSW 10 67,964,628 (GRCm39) missense possibly damaging 0.82
R9272:Arid5b UTSW 10 67,937,882 (GRCm39) missense probably damaging 0.99
R9430:Arid5b UTSW 10 68,022,087 (GRCm39) critical splice acceptor site probably null
X0066:Arid5b UTSW 10 67,954,132 (GRCm39) missense probably damaging 1.00
Z1177:Arid5b UTSW 10 67,933,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTAACCAGAGAGCATGCTATG -3'
(R):5'- AGCAGTCTGTTCTCTTCTGAATG -3'

Sequencing Primer
(F):5'- TAACCAGAGAGCATGCTATGTAAAG -3'
(R):5'- GTTGCATAGAATGAATGACCCTGGTC -3'
Posted On 2019-10-07