Incidental Mutation 'R7432:Stab2'
ID 576565
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms FEEL-2, STAB-2
MMRRC Submission 045510-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7432 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86677062-86843889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86721547 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1526 (E1526G)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably damaging
Transcript: ENSMUST00000035288
AA Change: E1526G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: E1526G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,468,839 (GRCm39) I31V probably benign Het
Adamts17 A G 7: 66,701,665 (GRCm39) K40E Het
Akr1c14 G A 13: 4,138,952 (GRCm39) D312N probably benign Het
Alg6 T C 4: 99,641,295 (GRCm39) V398A probably benign Het
Ankmy1 A T 1: 92,823,801 (GRCm39) M155K probably benign Het
Arid5b C A 10: 67,954,096 (GRCm39) R396L probably damaging Het
Armt1 C A 10: 4,382,706 (GRCm39) D12E probably benign Het
Arrb2 T A 11: 70,328,796 (GRCm39) N217K probably benign Het
Atg2b A T 12: 105,627,463 (GRCm39) L508Q probably damaging Het
Atg2b A T 12: 105,630,957 (GRCm39) S323T probably benign Het
Atp1a3 G A 7: 24,705,300 (GRCm39) probably benign Het
Atp6v0e T C 17: 26,901,672 (GRCm39) V42A probably benign Het
Atp9b A G 18: 80,809,056 (GRCm39) V621A Het
Atrnl1 A C 19: 57,743,956 (GRCm39) D1186A probably damaging Het
Atxn2l A T 7: 126,093,046 (GRCm39) M821K possibly damaging Het
Blnk G A 19: 40,948,301 (GRCm39) R123* probably null Het
Bud13 T A 9: 46,198,372 (GRCm39) S98T probably benign Het
Ccdc183 T C 2: 25,499,469 (GRCm39) M455V probably benign Het
Cd109 A G 9: 78,622,225 (GRCm39) Y1405C possibly damaging Het
Cdan1 A T 2: 120,553,236 (GRCm39) L989Q probably damaging Het
Clec16a T C 16: 10,506,419 (GRCm39) I713T possibly damaging Het
Clta T A 4: 44,032,419 (GRCm39) F168L possibly damaging Het
Cnnm1 A T 19: 43,456,710 (GRCm39) H583L probably benign Het
Cyp4f18 A G 8: 72,749,906 (GRCm39) Y248H probably benign Het
Dsg4 G T 18: 20,579,323 (GRCm39) G20* probably null Het
Dusp12 T A 1: 170,707,345 (GRCm39) K248* probably null Het
Eeig2 C T 3: 108,910,723 (GRCm39) A51T probably damaging Het
Elp1 C T 4: 56,776,925 (GRCm39) G624D probably damaging Het
Fhod3 A G 18: 25,134,966 (GRCm39) D359G possibly damaging Het
Frmpd2 C A 14: 33,229,510 (GRCm39) F365L probably damaging Het
Gab1 A G 8: 81,515,298 (GRCm39) I340T probably benign Het
Gabpa C T 16: 84,654,408 (GRCm39) Q362* probably null Het
Gcnt2 A T 13: 41,040,688 (GRCm39) probably benign Het
Gm12728 T A 4: 105,651,486 (GRCm39) L32Q probably damaging Het
Gpatch4 A G 3: 87,959,003 (GRCm39) N35D probably damaging Het
Grid2 G T 6: 64,252,854 (GRCm39) V441L possibly damaging Het
H2-M2 A G 17: 37,792,361 (GRCm39) probably null Het
Hip1r T C 5: 124,129,829 (GRCm39) F180L probably benign Het
Il17re T C 6: 113,439,332 (GRCm39) F81L probably benign Het
Il3ra T C 14: 14,350,691 (GRCm38) V235A possibly damaging Het
Krtap6-2 C T 16: 89,216,761 (GRCm39) G69S unknown Het
Lmln T C 16: 32,909,738 (GRCm39) L373P probably damaging Het
Lmo7 C A 14: 102,139,551 (GRCm39) Q945K probably benign Het
Loxhd1 G T 18: 77,383,547 (GRCm39) V149L possibly damaging Het
Lrrc73 T C 17: 46,566,709 (GRCm39) probably null Het
Mapkapk5 G A 5: 121,675,234 (GRCm39) H112Y possibly damaging Het
Maz A G 7: 126,622,220 (GRCm39) V467A probably benign Het
Med13l T G 5: 118,890,003 (GRCm39) V1884G probably damaging Het
Nlrp12 A C 7: 3,271,213 (GRCm39) N1033K probably benign Het
Nos3 T A 5: 24,572,613 (GRCm39) V184E probably damaging Het
Npr2 T C 4: 43,647,155 (GRCm39) V737A probably damaging Het
Nsd1 A G 13: 55,361,187 (GRCm39) T52A probably benign Het
Obscn C T 11: 58,919,733 (GRCm39) R108Q Het
Or4k50-ps1 A G 2: 111,522,401 (GRCm39) *179W probably null Het
Or4x11 A T 2: 89,867,528 (GRCm39) K88N probably damaging Het
Or5t5 G T 2: 86,616,565 (GRCm39) G164* probably null Het
Or5w22 T C 2: 87,362,784 (GRCm39) S136P probably damaging Het
Or6c70 T C 10: 129,709,719 (GRCm39) I302M probably benign Het
Or9a4 C A 6: 40,549,240 (GRCm39) R307S probably benign Het
Ovol2 A G 2: 144,159,792 (GRCm39) V116A probably benign Het
Pcdha5 C A 18: 37,095,379 (GRCm39) S629R probably benign Het
Pde4dip T A 3: 97,602,408 (GRCm39) M2274L probably benign Het
Pdpk1 T C 17: 24,320,643 (GRCm39) T185A probably benign Het
Pip5k1a T G 3: 94,981,431 (GRCm39) T67P probably benign Het
Plat G T 8: 23,263,667 (GRCm39) V189F probably damaging Het
Ppm1a C T 12: 72,830,916 (GRCm39) S147L probably damaging Het
Prim1 T A 10: 127,851,885 (GRCm39) D52E probably damaging Het
Prkab1 C G 5: 116,162,221 (GRCm39) D30H possibly damaging Het
Psma6 A T 12: 55,445,613 (GRCm39) probably benign Het
Psmd2 T A 16: 20,473,675 (GRCm39) M196K probably damaging Het
Ralgapa2 G T 2: 146,276,776 (GRCm39) T488K probably benign Het
Rapgefl1 A G 11: 98,741,940 (GRCm39) K635E probably damaging Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs11 G A 17: 26,426,734 (GRCm39) V289M probably damaging Het
Ro60 T C 1: 143,641,548 (GRCm39) I304M probably benign Het
Scmh1 T C 4: 120,386,353 (GRCm39) L631P probably damaging Het
Sema3e T G 5: 14,274,404 (GRCm39) D218E probably damaging Het
Sh3rf2 T C 18: 42,187,091 (GRCm39) V70A probably damaging Het
Slc12a1 G T 2: 125,047,960 (GRCm39) V801L probably benign Het
Slc25a51 C G 4: 45,399,765 (GRCm39) A142P possibly damaging Het
Slc41a1 C T 1: 131,758,694 (GRCm39) T112I probably damaging Het
Slc44a2 T C 9: 21,254,511 (GRCm39) M264T probably benign Het
Snapc1 T A 12: 74,015,068 (GRCm39) M134K probably benign Het
Snrk T C 9: 121,986,276 (GRCm39) F215S probably damaging Het
Tbc1d10a C A 11: 4,163,016 (GRCm39) Y260* probably null Het
Tdrd5 A T 1: 156,130,002 (GRCm39) L56Q probably damaging Het
Tenm2 T C 11: 36,755,768 (GRCm39) T77A probably benign Het
Tmprss11g T G 5: 86,644,366 (GRCm39) R159S possibly damaging Het
Traj38 T A 14: 54,418,034 (GRCm39) N1K Het
Ttn A G 2: 76,596,631 (GRCm39) I20094T possibly damaging Het
Ubr4 T C 4: 139,115,693 (GRCm39) L64P probably damaging Het
Utp20 C T 10: 88,634,260 (GRCm39) R812Q probably benign Het
Vmn2r57 C A 7: 41,076,148 (GRCm39) V455L probably benign Het
Wdcp T C 12: 4,900,246 (GRCm39) V34A probably damaging Het
Zfp27 C T 7: 29,594,784 (GRCm39) V394I probably benign Het
Zfp512b T C 2: 181,231,649 (GRCm39) H177R probably benign Het
Zfp648 T A 1: 154,080,783 (GRCm39) M314K possibly damaging Het
Zfp811 T C 17: 33,017,733 (GRCm39) I102M possibly damaging Het
Zkscan6 A G 11: 65,705,189 (GRCm39) probably null Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,705,070 (GRCm39) splice site probably null
IGL00809:Stab2 APN 10 86,684,038 (GRCm39) splice site probably benign
IGL00911:Stab2 APN 10 86,805,617 (GRCm39) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,737,567 (GRCm39) splice site probably null
IGL01411:Stab2 APN 10 86,815,872 (GRCm39) splice site probably benign
IGL01503:Stab2 APN 10 86,776,477 (GRCm39) splice site probably benign
IGL01599:Stab2 APN 10 86,758,759 (GRCm39) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,816,992 (GRCm39) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,790,035 (GRCm39) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,805,141 (GRCm39) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,707,695 (GRCm39) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,803,514 (GRCm39) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,695,606 (GRCm39) splice site probably null
IGL02600:Stab2 APN 10 86,790,123 (GRCm39) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,686,766 (GRCm39) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,682,027 (GRCm39) splice site probably benign
IGL02709:Stab2 APN 10 86,682,029 (GRCm39) splice site probably benign
IGL02728:Stab2 APN 10 86,692,420 (GRCm39) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,786,133 (GRCm39) splice site probably benign
IGL02938:Stab2 APN 10 86,707,785 (GRCm39) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,832,667 (GRCm39) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,690,985 (GRCm39) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,805,165 (GRCm39) missense probably benign 0.03
prospector UTSW 10 86,737,431 (GRCm39) splice site probably null
songbird UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,705,041 (GRCm39) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,691,035 (GRCm39) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,779,153 (GRCm39) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,703,039 (GRCm39) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,697,299 (GRCm39) nonsense probably null
R0015:Stab2 UTSW 10 86,679,481 (GRCm39) missense probably benign
R0254:Stab2 UTSW 10 86,733,824 (GRCm39) missense probably benign
R0310:Stab2 UTSW 10 86,803,477 (GRCm39) splice site probably benign
R0333:Stab2 UTSW 10 86,677,491 (GRCm39) missense probably benign
R0391:Stab2 UTSW 10 86,783,008 (GRCm39) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,708,474 (GRCm39) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,679,355 (GRCm39) splice site probably benign
R0440:Stab2 UTSW 10 86,785,792 (GRCm39) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,723,759 (GRCm39) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,805,735 (GRCm39) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,760,314 (GRCm39) splice site probably benign
R1078:Stab2 UTSW 10 86,742,997 (GRCm39) splice site probably null
R1118:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1119:Stab2 UTSW 10 86,695,619 (GRCm39) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,786,165 (GRCm39) missense probably damaging 0.98
R1440:Stab2 UTSW 10 86,697,231 (GRCm39) splice site probably null
R1550:Stab2 UTSW 10 86,714,790 (GRCm39) missense probably benign 0.01
R1616:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1728:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1768:Stab2 UTSW 10 86,838,872 (GRCm39) missense probably damaging 1.00
R1772:Stab2 UTSW 10 86,790,098 (GRCm39) missense probably benign 0.06
R1776:Stab2 UTSW 10 86,793,680 (GRCm39) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,773,913 (GRCm39) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,697,334 (GRCm39) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,796,180 (GRCm39) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1996:Stab2 UTSW 10 86,838,895 (GRCm39) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,790,023 (GRCm39) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,700,904 (GRCm39) nonsense probably null
R2169:Stab2 UTSW 10 86,723,726 (GRCm39) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,776,503 (GRCm39) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,805,183 (GRCm39) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,770,704 (GRCm39) splice site probably benign
R2696:Stab2 UTSW 10 86,697,363 (GRCm39) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,803,550 (GRCm39) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,697,325 (GRCm39) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,702,572 (GRCm39) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,805,141 (GRCm39) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,785,776 (GRCm39) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,714,750 (GRCm39) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,699,320 (GRCm39) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,693,988 (GRCm39) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,758,049 (GRCm39) missense probably damaging 1.00
R4151:Stab2 UTSW 10 86,838,847 (GRCm39) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,714,808 (GRCm39) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,803,543 (GRCm39) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,743,235 (GRCm39) nonsense probably null
R4825:Stab2 UTSW 10 86,783,011 (GRCm39) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,679,364 (GRCm39) splice site probably null
R4871:Stab2 UTSW 10 86,778,099 (GRCm39) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,790,026 (GRCm39) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,796,087 (GRCm39) missense probably benign
R4994:Stab2 UTSW 10 86,785,771 (GRCm39) missense probably benign
R4999:Stab2 UTSW 10 86,773,773 (GRCm39) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,743,249 (GRCm39) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,707,674 (GRCm39) splice site probably null
R5213:Stab2 UTSW 10 86,743,061 (GRCm39) missense probably damaging 0.99
R5508:Stab2 UTSW 10 86,796,143 (GRCm39) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,783,026 (GRCm39) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,683,989 (GRCm39) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,708,555 (GRCm39) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,805,713 (GRCm39) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,773,906 (GRCm39) missense probably damaging 0.99
R6019:Stab2 UTSW 10 86,838,886 (GRCm39) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,743,054 (GRCm39) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,719,642 (GRCm39) splice site probably null
R6209:Stab2 UTSW 10 86,758,867 (GRCm39) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,743,025 (GRCm39) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,737,431 (GRCm39) splice site probably null
R6787:Stab2 UTSW 10 86,754,948 (GRCm39) missense probably benign 0.07
R6841:Stab2 UTSW 10 86,778,054 (GRCm39) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,697,230 (GRCm39) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,686,701 (GRCm39) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,706,110 (GRCm39) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,741,456 (GRCm39) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,735,705 (GRCm39) missense probably damaging 0.99
R7271:Stab2 UTSW 10 86,838,972 (GRCm39) splice site probably null
R7291:Stab2 UTSW 10 86,782,084 (GRCm39) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,805,049 (GRCm39) nonsense probably null
R7580:Stab2 UTSW 10 86,705,028 (GRCm39) missense probably benign 0.00
R7622:Stab2 UTSW 10 86,709,766 (GRCm39) missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86,719,646 (GRCm39) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,816,999 (GRCm39) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,793,776 (GRCm39) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,708,483 (GRCm39) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,832,758 (GRCm39) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,808,745 (GRCm39) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,714,776 (GRCm39) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,790,056 (GRCm39) nonsense probably null
R7947:Stab2 UTSW 10 86,681,897 (GRCm39) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,683,887 (GRCm39) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,686,767 (GRCm39) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,741,403 (GRCm39) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,681,916 (GRCm39) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,704,959 (GRCm39) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,709,728 (GRCm39) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,803,598 (GRCm39) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,776,587 (GRCm39) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,808,794 (GRCm39) missense probably damaging 0.99
R8744:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8745:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,735,685 (GRCm39) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,832,728 (GRCm39) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,785,782 (GRCm39) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,727,481 (GRCm39) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,791,010 (GRCm39) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,699,420 (GRCm39) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,793,704 (GRCm39) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,686,651 (GRCm39) nonsense probably null
R9648:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9649:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9650:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9726:Stab2 UTSW 10 86,790,095 (GRCm39) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,803,553 (GRCm39) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,757,997 (GRCm39) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,702,622 (GRCm39) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,758,062 (GRCm39) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,723,680 (GRCm39) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,785,778 (GRCm39) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,732,460 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACATGGGGTTTGCAGATG -3'
(R):5'- CCCCACAGAGTTACTTCTGC -3'

Sequencing Primer
(F):5'- GTGTATACCCCATCTTTAGAAAGCC -3'
(R):5'- TGCCTCTGAACTTCCAGAACACTG -3'
Posted On 2019-10-07