Incidental Mutation 'R7432:Utp20'
ID576566
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R7432 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88798398 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 812 (R812Q)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: R812Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: R812Q

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,518,839 I31V probably benign Het
Adamts17 A G 7: 67,051,917 K40E Het
Akr1c14 G A 13: 4,088,952 D312N probably benign Het
Alg6 T C 4: 99,753,058 V398A probably benign Het
Ankmy1 A T 1: 92,896,079 M155K probably benign Het
Arid5b C A 10: 68,118,266 R396L probably damaging Het
Armt1 C A 10: 4,432,706 D12E probably benign Het
Arrb2 T A 11: 70,437,970 N217K probably benign Het
Atg2b A T 12: 105,661,204 L508Q probably damaging Het
Atg2b A T 12: 105,664,698 S323T probably benign Het
Atp1a3 G A 7: 25,005,875 probably benign Het
Atp6v0e T C 17: 26,682,698 V42A probably benign Het
Atp9b A G 18: 80,765,841 V621A Het
Atrnl1 A C 19: 57,755,524 D1186A probably damaging Het
Atxn2l A T 7: 126,493,874 M821K possibly damaging Het
Blnk G A 19: 40,959,857 R123* probably null Het
Bud13 T A 9: 46,287,074 S98T probably benign Het
Ccdc183 T C 2: 25,609,457 M455V probably benign Het
Cd109 A G 9: 78,714,943 Y1405C possibly damaging Het
Cdan1 A T 2: 120,722,755 L989Q probably damaging Het
Clec16a T C 16: 10,688,555 I713T possibly damaging Het
Clta T A 4: 44,032,419 F168L possibly damaging Het
Cnnm1 A T 19: 43,468,271 H583L probably benign Het
Cyp4f18 A G 8: 71,996,062 Y248H probably benign Het
Dsg4 G T 18: 20,446,266 G20* probably null Het
Dusp12 T A 1: 170,879,776 K248* probably null Het
Fam102b C T 3: 109,003,407 A51T probably damaging Het
Fhod3 A G 18: 25,001,909 D359G possibly damaging Het
Frmpd2 C A 14: 33,507,553 F365L probably damaging Het
Gab1 A G 8: 80,788,669 I340T probably benign Het
Gabpa C T 16: 84,857,520 Q362* probably null Het
Gcnt2 A T 13: 40,887,212 probably benign Het
Gm12728 T A 4: 105,794,289 L32Q probably damaging Het
Gpatch4 A G 3: 88,051,696 N35D probably damaging Het
Grid2 G T 6: 64,275,870 V441L possibly damaging Het
H2-M2 A G 17: 37,481,470 probably null Het
Hip1r T C 5: 123,991,766 F180L probably benign Het
Ikbkap C T 4: 56,776,925 G624D probably damaging Het
Il17re T C 6: 113,462,371 F81L probably benign Het
Il3ra T C 14: 14,350,691 V235A possibly damaging Het
Krtap6-2 C T 16: 89,419,873 G69S unknown Het
Lmln T C 16: 33,089,368 L373P probably damaging Het
Lmo7 C A 14: 101,902,115 Q945K probably benign Het
Loxhd1 G T 18: 77,295,851 V149L possibly damaging Het
Lrrc73 T C 17: 46,255,783 probably null Het
Mapkapk5 G A 5: 121,537,171 H112Y possibly damaging Het
Maz A G 7: 127,023,048 V467A probably benign Het
Med13l T G 5: 118,751,938 V1884G probably damaging Het
Nlrp12 A C 7: 3,222,539 N1033K probably benign Het
Nos3 T A 5: 24,367,615 V184E probably damaging Het
Npr2 T C 4: 43,647,155 V737A probably damaging Het
Nsd1 A G 13: 55,213,374 T52A probably benign Het
Obscn C T 11: 59,028,907 R108Q Het
Olfr1093 G T 2: 86,786,221 G164* probably null Het
Olfr1265 A T 2: 90,037,184 K88N probably damaging Het
Olfr1300-ps1 A G 2: 111,692,056 *179W probably null Het
Olfr153 T C 2: 87,532,440 S136P probably damaging Het
Olfr460 C A 6: 40,572,306 R307S probably benign Het
Olfr814 T C 10: 129,873,850 I302M probably benign Het
Ovol2 A G 2: 144,317,872 V116A probably benign Het
Pcdha5 C A 18: 36,962,326 S629R probably benign Het
Pde4dip T A 3: 97,695,092 M2274L probably benign Het
Pdpk1 T C 17: 24,101,669 T185A probably benign Het
Pip5k1a T G 3: 95,074,120 T67P probably benign Het
Plat G T 8: 22,773,651 V189F probably damaging Het
Ppm1a C T 12: 72,784,142 S147L probably damaging Het
Prim1 T A 10: 128,016,016 D52E probably damaging Het
Prkab1 C G 5: 116,024,162 D30H possibly damaging Het
Psma6 A T 12: 55,398,828 probably benign Het
Psmd2 T A 16: 20,654,925 M196K probably damaging Het
Ralgapa2 G T 2: 146,434,856 T488K probably benign Het
Rapgefl1 A G 11: 98,851,114 K635E probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs11 G A 17: 26,207,760 V289M probably damaging Het
Scmh1 T C 4: 120,529,156 L631P probably damaging Het
Sema3e T G 5: 14,224,390 D218E probably damaging Het
Sh3rf2 T C 18: 42,054,026 V70A probably damaging Het
Slc12a1 G T 2: 125,206,040 V801L probably benign Het
Slc25a51 C G 4: 45,399,765 A142P possibly damaging Het
Slc41a1 C T 1: 131,830,956 T112I probably damaging Het
Slc44a2 T C 9: 21,343,215 M264T probably benign Het
Snapc1 T A 12: 73,968,294 M134K probably benign Het
Snrk T C 9: 122,157,210 F215S probably damaging Het
Stab2 T C 10: 86,885,683 E1526G probably damaging Het
Tbc1d10a C A 11: 4,213,016 Y260* probably null Het
Tdrd5 A T 1: 156,302,432 L56Q probably damaging Het
Tenm2 T C 11: 36,864,941 T77A probably benign Het
Tmprss11g T G 5: 86,496,507 R159S possibly damaging Het
Traj38 T A 14: 54,180,577 N1K Het
Trove2 T C 1: 143,765,810 I304M probably benign Het
Ttn A G 2: 76,766,287 I20094T possibly damaging Het
Ubr4 T C 4: 139,388,382 L64P probably damaging Het
Vmn2r57 C A 7: 41,426,724 V455L probably benign Het
Wdcp T C 12: 4,850,246 V34A probably damaging Het
Zfp27 C T 7: 29,895,359 V394I probably benign Het
Zfp512b T C 2: 181,589,856 H177R probably benign Het
Zfp648 T A 1: 154,205,037 M314K possibly damaging Het
Zfp811 T C 17: 32,798,759 I102M possibly damaging Het
Zkscan6 A G 11: 65,814,363 probably null Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
R7473:Utp20 UTSW 10 88820710 splice site probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7831:Utp20 UTSW 10 88762770 nonsense probably null
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7956:Utp20 UTSW 10 88782614 missense probably benign 0.23
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
R8415:Utp20 UTSW 10 88826604 critical splice donor site probably null
R8466:Utp20 UTSW 10 88818503 missense probably damaging 1.00
R8505:Utp20 UTSW 10 88818008 missense probably benign 0.03
R8802:Utp20 UTSW 10 88747295 missense probably damaging 1.00
R8923:Utp20 UTSW 10 88791742 nonsense probably null
R8945:Utp20 UTSW 10 88792670 nonsense probably null
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAAGTGCTTTGCAGACATG -3'
(R):5'- AGCAGTGGTCTACAGGCTTG -3'

Sequencing Primer
(F):5'- AGTGCTTTGCAGACATGATAATGG -3'
(R):5'- CTACAGGCTTGAGAGTGACACTTTTC -3'
Posted On2019-10-07