Incidental Mutation 'R0627:Mylk'
ID 57658
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 038816-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0627 (G1)
Quality Score 156
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34820799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 126 (N126S)
Ref Sequence ENSEMBL: ENSMUSP00000156149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538] [ENSMUST00000231589]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023538
AA Change: N1917S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: N1917S

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231589
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232649
Meta Mutation Damage Score 0.6236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 99% (111/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adm2 T A 15: 89,208,508 (GRCm39) Y149* probably null Het
Ahi1 G A 10: 20,841,421 (GRCm39) R236H probably benign Het
Armcx4 A G X: 133,596,572 (GRCm39) N2160S possibly damaging Het
Asns A T 6: 7,675,516 (GRCm39) D495E probably benign Het
Atosb G T 4: 43,036,242 (GRCm39) P163Q probably damaging Het
Bcl9 A G 3: 97,112,789 (GRCm39) V1222A probably damaging Het
Cd46 A T 1: 194,774,494 (GRCm39) C14S probably benign Het
Cdk11b T A 4: 155,725,229 (GRCm39) probably benign Het
Cdkl3 T C 11: 51,902,135 (GRCm39) Y115H probably damaging Het
Cep41 C A 6: 30,656,630 (GRCm39) C274F probably damaging Het
Ces1a C A 8: 93,768,671 (GRCm39) V108F probably benign Het
Clca4b A G 3: 144,634,020 (GRCm39) Y132H probably benign Het
Col5a3 T C 9: 20,686,781 (GRCm39) E1323G unknown Het
Cttnbp2 A G 6: 18,367,372 (GRCm39) *1139Q probably null Het
Cyp2d9 T A 15: 82,339,991 (GRCm39) I127N probably damaging Het
Dennd1b A G 1: 139,008,957 (GRCm39) Y220C probably damaging Het
Desi2 T C 1: 178,076,918 (GRCm39) S141P possibly damaging Het
Dgcr2 A G 16: 17,661,872 (GRCm39) S453P probably damaging Het
Dnah3 A G 7: 119,620,138 (GRCm39) L1586P probably damaging Het
Dpep3 T C 8: 106,705,363 (GRCm39) D129G possibly damaging Het
Eci3 C T 13: 35,132,126 (GRCm39) V241I possibly damaging Het
Ecm2 A T 13: 49,674,559 (GRCm39) probably benign Het
Emilin3 A G 2: 160,750,096 (GRCm39) L551P probably damaging Het
Erap1 A C 13: 74,823,933 (GRCm39) probably benign Het
Ern1 T C 11: 106,289,519 (GRCm39) D928G probably benign Het
Fancc C A 13: 63,465,292 (GRCm39) A472S probably damaging Het
Fkbp7 A T 2: 76,503,188 (GRCm39) D57E probably damaging Het
Gabbr2 T A 4: 46,681,223 (GRCm39) I703F possibly damaging Het
Gabrg3 A T 7: 56,374,343 (GRCm39) C408S probably damaging Het
Gm8674 T C 13: 50,053,751 (GRCm39) noncoding transcript Het
Gnas G A 2: 174,139,928 (GRCm39) probably benign Het
Grhl3 A G 4: 135,279,992 (GRCm39) V354A probably benign Het
Gsdme G T 6: 50,206,259 (GRCm39) probably benign Het
H2-D1 A G 17: 35,484,898 (GRCm39) E253G probably damaging Het
Habp2 A G 19: 56,302,478 (GRCm39) T31A probably damaging Het
Ifrd1 A G 12: 40,256,986 (GRCm39) probably null Het
Il20 A G 1: 130,837,476 (GRCm39) probably benign Het
Isx A T 8: 75,619,328 (GRCm39) I160F possibly damaging Het
Itgb2l T G 16: 96,224,111 (GRCm39) probably benign Het
Kcnv1 T G 15: 44,976,277 (GRCm39) probably benign Het
Kif17 T C 4: 138,015,798 (GRCm39) probably null Het
Kirrel3 A C 9: 34,946,470 (GRCm39) D743A probably damaging Het
Lmod3 T C 6: 97,225,032 (GRCm39) D263G probably damaging Het
Manf A G 9: 106,766,385 (GRCm39) L132P probably damaging Het
Mark2 C T 19: 7,259,325 (GRCm39) probably null Het
Med10 G A 13: 69,963,720 (GRCm39) S107N possibly damaging Het
Med31 A G 11: 72,104,601 (GRCm39) probably null Het
Mki67 C A 7: 135,309,987 (GRCm39) A155S probably benign Het
Mprip T A 11: 59,660,798 (GRCm39) L2193Q probably damaging Het
Myo16 A G 8: 10,489,689 (GRCm39) I715V probably benign Het
Myo18b T C 5: 112,946,700 (GRCm39) T1591A probably benign Het
Myt1 T A 2: 181,437,482 (GRCm39) D64E probably benign Het
Ndufa10 A T 1: 92,397,618 (GRCm39) Y61N probably damaging Het
Nob1 A G 8: 108,142,856 (GRCm39) F275S probably damaging Het
Nop2 T C 6: 125,116,667 (GRCm39) V333A possibly damaging Het
Ogdh T A 11: 6,297,216 (GRCm39) V545D possibly damaging Het
Or1l4b T G 2: 37,036,342 (GRCm39) N39K probably damaging Het
Or4p21 A G 2: 88,276,563 (GRCm39) S240P probably damaging Het
Or5b107 A G 19: 13,142,614 (GRCm39) T79A probably benign Het
Or5t16 T C 2: 86,819,358 (GRCm39) N54S probably benign Het
Or6d13 T A 6: 116,517,949 (GRCm39) N178K possibly damaging Het
Or6n2 G T 1: 173,897,643 (GRCm39) V260F probably damaging Het
Or9k2b A G 10: 130,016,557 (GRCm39) F64S probably damaging Het
Pcdhb1 T C 18: 37,398,774 (GRCm39) F242L probably damaging Het
Pkd2l2 A G 18: 34,558,155 (GRCm39) Y278C probably damaging Het
Plxdc1 T A 11: 97,823,030 (GRCm39) probably null Het
Ppp2r5b A G 19: 6,282,664 (GRCm39) probably benign Het
Pramel31 C A 4: 144,089,416 (GRCm39) L245I probably benign Het
Prelid2 T A 18: 42,070,717 (GRCm39) T39S possibly damaging Het
Prkd1 A T 12: 50,536,824 (GRCm39) F87I probably benign Het
Prl3d3 C T 13: 27,340,830 (GRCm39) T4I probably damaging Het
Proser3 T A 7: 30,240,208 (GRCm39) T299S probably benign Het
Ptprc G T 1: 137,996,058 (GRCm39) H1095N probably damaging Het
Rab11fip5 G T 6: 85,325,033 (GRCm39) P425T probably benign Het
Rac2 T C 15: 78,449,168 (GRCm39) T115A probably damaging Het
Rtl9 C A X: 141,884,271 (GRCm39) T561K possibly damaging Het
Runx2 T C 17: 44,969,392 (GRCm39) probably benign Het
Rxfp1 C T 3: 79,555,518 (GRCm39) V613I probably benign Het
Scn9a T C 2: 66,367,721 (GRCm39) K656R probably benign Het
Sec31b A G 19: 44,514,046 (GRCm39) S406P probably benign Het
Septin5 T C 16: 18,444,115 (GRCm39) D44G possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc35c2 T C 2: 165,124,056 (GRCm39) T94A possibly damaging Het
Slc8a3 T A 12: 81,361,616 (GRCm39) D401V probably damaging Het
Slitrk1 A T 14: 109,149,671 (GRCm39) C347S probably damaging Het
Smg1 G T 7: 117,767,084 (GRCm39) probably benign Het
Snx14 T C 9: 88,276,483 (GRCm39) K610E probably benign Het
Spata31e2 A G 1: 26,724,970 (GRCm39) M70T probably benign Het
Sppl2a A G 2: 126,762,337 (GRCm39) probably benign Het
Stk-ps2 T A 1: 46,068,851 (GRCm39) noncoding transcript Het
Sult3a1 T C 10: 33,740,010 (GRCm39) M23T probably benign Het
Syt5 A G 7: 4,548,682 (GRCm39) L50P possibly damaging Het
Tacr1 A G 6: 82,532,012 (GRCm39) I303V possibly damaging Het
Trip12 C A 1: 84,746,318 (GRCm39) V487F probably damaging Het
Vcp A G 4: 42,983,011 (GRCm39) S612P possibly damaging Het
Vmn1r47 A G 6: 89,999,788 (GRCm39) I307V probably null Het
Vmn1r83 T G 7: 12,055,919 (GRCm39) D46A probably damaging Het
Vmn2r118 G T 17: 55,917,772 (GRCm39) Q247K probably benign Het
Vmn2r94 C T 17: 18,477,427 (GRCm39) C328Y probably damaging Het
Vps13b T A 15: 35,372,145 (GRCm39) Y13* probably null Het
Vps13d C T 4: 144,813,754 (GRCm39) R3241H probably damaging Het
Wdr5b A G 16: 35,862,840 (GRCm39) T320A probably benign Het
Zfhx2 A T 14: 55,302,784 (GRCm39) D1733E probably benign Het
Zfp541 A G 7: 15,829,607 (GRCm39) probably benign Het
Zfp708 A T 13: 67,218,781 (GRCm39) Y314* probably null Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5195:Mylk UTSW 16 34,799,585 (GRCm39) missense probably damaging 1.00
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GCCAACCTCGTGCTTTAATCAACAG -3'
(R):5'- AGTATATCTCCCAGGCATCAGCCG -3'

Sequencing Primer
(F):5'- GTACCCTGAGAGCCTCTTGATTG -3'
(R):5'- GCCTTTTCTAGCTTTGGtttttttg -3'
Posted On 2013-07-11