Incidental Mutation 'R7432:Atg2b'
ID 576580
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Name autophagy related 2B
Synonyms C030004M05Rik, 2410024A21Rik, C630028L02Rik
MMRRC Submission 045510-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R7432 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 105582395-105651470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105627463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 508 (L508Q)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
AlphaFold Q80XK6
Predicted Effect probably damaging
Transcript: ENSMUST00000041055
AA Change: L508Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: L508Q

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,468,839 (GRCm39) I31V probably benign Het
Adamts17 A G 7: 66,701,665 (GRCm39) K40E Het
Akr1c14 G A 13: 4,138,952 (GRCm39) D312N probably benign Het
Alg6 T C 4: 99,641,295 (GRCm39) V398A probably benign Het
Ankmy1 A T 1: 92,823,801 (GRCm39) M155K probably benign Het
Arid5b C A 10: 67,954,096 (GRCm39) R396L probably damaging Het
Armt1 C A 10: 4,382,706 (GRCm39) D12E probably benign Het
Arrb2 T A 11: 70,328,796 (GRCm39) N217K probably benign Het
Atp1a3 G A 7: 24,705,300 (GRCm39) probably benign Het
Atp6v0e T C 17: 26,901,672 (GRCm39) V42A probably benign Het
Atp9b A G 18: 80,809,056 (GRCm39) V621A Het
Atrnl1 A C 19: 57,743,956 (GRCm39) D1186A probably damaging Het
Atxn2l A T 7: 126,093,046 (GRCm39) M821K possibly damaging Het
Blnk G A 19: 40,948,301 (GRCm39) R123* probably null Het
Bud13 T A 9: 46,198,372 (GRCm39) S98T probably benign Het
Ccdc183 T C 2: 25,499,469 (GRCm39) M455V probably benign Het
Cd109 A G 9: 78,622,225 (GRCm39) Y1405C possibly damaging Het
Cdan1 A T 2: 120,553,236 (GRCm39) L989Q probably damaging Het
Clec16a T C 16: 10,506,419 (GRCm39) I713T possibly damaging Het
Clta T A 4: 44,032,419 (GRCm39) F168L possibly damaging Het
Cnnm1 A T 19: 43,456,710 (GRCm39) H583L probably benign Het
Cyp4f18 A G 8: 72,749,906 (GRCm39) Y248H probably benign Het
Dsg4 G T 18: 20,579,323 (GRCm39) G20* probably null Het
Dusp12 T A 1: 170,707,345 (GRCm39) K248* probably null Het
Eeig2 C T 3: 108,910,723 (GRCm39) A51T probably damaging Het
Elp1 C T 4: 56,776,925 (GRCm39) G624D probably damaging Het
Fhod3 A G 18: 25,134,966 (GRCm39) D359G possibly damaging Het
Frmpd2 C A 14: 33,229,510 (GRCm39) F365L probably damaging Het
Gab1 A G 8: 81,515,298 (GRCm39) I340T probably benign Het
Gabpa C T 16: 84,654,408 (GRCm39) Q362* probably null Het
Gcnt2 A T 13: 41,040,688 (GRCm39) probably benign Het
Gm12728 T A 4: 105,651,486 (GRCm39) L32Q probably damaging Het
Gpatch4 A G 3: 87,959,003 (GRCm39) N35D probably damaging Het
Grid2 G T 6: 64,252,854 (GRCm39) V441L possibly damaging Het
H2-M2 A G 17: 37,792,361 (GRCm39) probably null Het
Hip1r T C 5: 124,129,829 (GRCm39) F180L probably benign Het
Il17re T C 6: 113,439,332 (GRCm39) F81L probably benign Het
Il3ra T C 14: 14,350,691 (GRCm38) V235A possibly damaging Het
Krtap6-2 C T 16: 89,216,761 (GRCm39) G69S unknown Het
Lmln T C 16: 32,909,738 (GRCm39) L373P probably damaging Het
Lmo7 C A 14: 102,139,551 (GRCm39) Q945K probably benign Het
Loxhd1 G T 18: 77,383,547 (GRCm39) V149L possibly damaging Het
Lrrc73 T C 17: 46,566,709 (GRCm39) probably null Het
Mapkapk5 G A 5: 121,675,234 (GRCm39) H112Y possibly damaging Het
Maz A G 7: 126,622,220 (GRCm39) V467A probably benign Het
Med13l T G 5: 118,890,003 (GRCm39) V1884G probably damaging Het
Nlrp12 A C 7: 3,271,213 (GRCm39) N1033K probably benign Het
Nos3 T A 5: 24,572,613 (GRCm39) V184E probably damaging Het
Npr2 T C 4: 43,647,155 (GRCm39) V737A probably damaging Het
Nsd1 A G 13: 55,361,187 (GRCm39) T52A probably benign Het
Obscn C T 11: 58,919,733 (GRCm39) R108Q Het
Or4k50-ps1 A G 2: 111,522,401 (GRCm39) *179W probably null Het
Or4x11 A T 2: 89,867,528 (GRCm39) K88N probably damaging Het
Or5t5 G T 2: 86,616,565 (GRCm39) G164* probably null Het
Or5w22 T C 2: 87,362,784 (GRCm39) S136P probably damaging Het
Or6c70 T C 10: 129,709,719 (GRCm39) I302M probably benign Het
Or9a4 C A 6: 40,549,240 (GRCm39) R307S probably benign Het
Ovol2 A G 2: 144,159,792 (GRCm39) V116A probably benign Het
Pcdha5 C A 18: 37,095,379 (GRCm39) S629R probably benign Het
Pde4dip T A 3: 97,602,408 (GRCm39) M2274L probably benign Het
Pdpk1 T C 17: 24,320,643 (GRCm39) T185A probably benign Het
Pip5k1a T G 3: 94,981,431 (GRCm39) T67P probably benign Het
Plat G T 8: 23,263,667 (GRCm39) V189F probably damaging Het
Ppm1a C T 12: 72,830,916 (GRCm39) S147L probably damaging Het
Prim1 T A 10: 127,851,885 (GRCm39) D52E probably damaging Het
Prkab1 C G 5: 116,162,221 (GRCm39) D30H possibly damaging Het
Psma6 A T 12: 55,445,613 (GRCm39) probably benign Het
Psmd2 T A 16: 20,473,675 (GRCm39) M196K probably damaging Het
Ralgapa2 G T 2: 146,276,776 (GRCm39) T488K probably benign Het
Rapgefl1 A G 11: 98,741,940 (GRCm39) K635E probably damaging Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs11 G A 17: 26,426,734 (GRCm39) V289M probably damaging Het
Ro60 T C 1: 143,641,548 (GRCm39) I304M probably benign Het
Scmh1 T C 4: 120,386,353 (GRCm39) L631P probably damaging Het
Sema3e T G 5: 14,274,404 (GRCm39) D218E probably damaging Het
Sh3rf2 T C 18: 42,187,091 (GRCm39) V70A probably damaging Het
Slc12a1 G T 2: 125,047,960 (GRCm39) V801L probably benign Het
Slc25a51 C G 4: 45,399,765 (GRCm39) A142P possibly damaging Het
Slc41a1 C T 1: 131,758,694 (GRCm39) T112I probably damaging Het
Slc44a2 T C 9: 21,254,511 (GRCm39) M264T probably benign Het
Snapc1 T A 12: 74,015,068 (GRCm39) M134K probably benign Het
Snrk T C 9: 121,986,276 (GRCm39) F215S probably damaging Het
Stab2 T C 10: 86,721,547 (GRCm39) E1526G probably damaging Het
Tbc1d10a C A 11: 4,163,016 (GRCm39) Y260* probably null Het
Tdrd5 A T 1: 156,130,002 (GRCm39) L56Q probably damaging Het
Tenm2 T C 11: 36,755,768 (GRCm39) T77A probably benign Het
Tmprss11g T G 5: 86,644,366 (GRCm39) R159S possibly damaging Het
Traj38 T A 14: 54,418,034 (GRCm39) N1K Het
Ttn A G 2: 76,596,631 (GRCm39) I20094T possibly damaging Het
Ubr4 T C 4: 139,115,693 (GRCm39) L64P probably damaging Het
Utp20 C T 10: 88,634,260 (GRCm39) R812Q probably benign Het
Vmn2r57 C A 7: 41,076,148 (GRCm39) V455L probably benign Het
Wdcp T C 12: 4,900,246 (GRCm39) V34A probably damaging Het
Zfp27 C T 7: 29,594,784 (GRCm39) V394I probably benign Het
Zfp512b T C 2: 181,231,649 (GRCm39) H177R probably benign Het
Zfp648 T A 1: 154,080,783 (GRCm39) M314K possibly damaging Het
Zfp811 T C 17: 33,017,733 (GRCm39) I102M possibly damaging Het
Zkscan6 A G 11: 65,705,189 (GRCm39) probably null Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105,611,175 (GRCm39) missense probably benign 0.20
IGL01326:Atg2b APN 12 105,588,403 (GRCm39) missense probably damaging 1.00
IGL02063:Atg2b APN 12 105,614,581 (GRCm39) missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105,602,699 (GRCm39) splice site probably benign
IGL02376:Atg2b APN 12 105,611,727 (GRCm39) missense probably damaging 1.00
IGL02381:Atg2b APN 12 105,614,607 (GRCm39) missense probably damaging 1.00
IGL02434:Atg2b APN 12 105,605,466 (GRCm39) missense probably benign 0.00
IGL02534:Atg2b APN 12 105,609,526 (GRCm39) missense probably damaging 1.00
IGL03011:Atg2b APN 12 105,592,621 (GRCm39) missense probably damaging 0.98
IGL03173:Atg2b APN 12 105,624,553 (GRCm39) missense possibly damaging 0.68
R6669_atg2b_067 UTSW 12 105,637,788 (GRCm39) missense possibly damaging 0.90
rail UTSW 12 105,625,099 (GRCm39) nonsense probably null
Sora UTSW 12 105,589,689 (GRCm39) missense probably benign 0.06
R0066:Atg2b UTSW 12 105,614,708 (GRCm39) missense probably benign
R0066:Atg2b UTSW 12 105,614,708 (GRCm39) missense probably benign
R0511:Atg2b UTSW 12 105,583,412 (GRCm39) missense probably damaging 1.00
R0762:Atg2b UTSW 12 105,641,229 (GRCm39) missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105,602,767 (GRCm39) missense probably benign 0.00
R1029:Atg2b UTSW 12 105,602,032 (GRCm39) missense probably damaging 0.96
R1529:Atg2b UTSW 12 105,627,392 (GRCm39) missense probably benign
R1563:Atg2b UTSW 12 105,589,747 (GRCm39) missense probably damaging 0.99
R1746:Atg2b UTSW 12 105,635,588 (GRCm39) missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105,620,351 (GRCm39) missense probably benign 0.01
R1956:Atg2b UTSW 12 105,635,677 (GRCm39) missense probably damaging 1.00
R1957:Atg2b UTSW 12 105,635,677 (GRCm39) missense probably damaging 1.00
R2272:Atg2b UTSW 12 105,604,267 (GRCm39) missense probably benign 0.00
R2877:Atg2b UTSW 12 105,630,268 (GRCm39) nonsense probably null
R2878:Atg2b UTSW 12 105,630,268 (GRCm39) nonsense probably null
R4798:Atg2b UTSW 12 105,618,888 (GRCm39) missense probably benign 0.37
R4836:Atg2b UTSW 12 105,613,073 (GRCm39) missense probably benign
R5007:Atg2b UTSW 12 105,610,135 (GRCm39) splice site probably null
R5042:Atg2b UTSW 12 105,587,521 (GRCm39) missense probably benign 0.01
R5134:Atg2b UTSW 12 105,641,209 (GRCm39) missense probably damaging 0.96
R5212:Atg2b UTSW 12 105,613,055 (GRCm39) missense probably benign 0.00
R5250:Atg2b UTSW 12 105,602,024 (GRCm39) missense probably damaging 1.00
R5307:Atg2b UTSW 12 105,624,588 (GRCm39) missense probably benign 0.17
R5342:Atg2b UTSW 12 105,625,175 (GRCm39) missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105,615,414 (GRCm39) missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105,587,587 (GRCm39) missense probably benign 0.00
R5660:Atg2b UTSW 12 105,615,383 (GRCm39) nonsense probably null
R5903:Atg2b UTSW 12 105,605,618 (GRCm39) missense possibly damaging 0.90
R6018:Atg2b UTSW 12 105,627,430 (GRCm39) missense probably damaging 0.96
R6153:Atg2b UTSW 12 105,589,741 (GRCm39) missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105,627,351 (GRCm39) nonsense probably null
R6584:Atg2b UTSW 12 105,624,254 (GRCm39) missense probably damaging 1.00
R6593:Atg2b UTSW 12 105,611,107 (GRCm39) missense probably damaging 1.00
R6669:Atg2b UTSW 12 105,637,788 (GRCm39) missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105,602,047 (GRCm39) missense probably damaging 1.00
R7003:Atg2b UTSW 12 105,620,508 (GRCm39) missense probably benign 0.01
R7193:Atg2b UTSW 12 105,630,967 (GRCm39) missense probably damaging 1.00
R7387:Atg2b UTSW 12 105,589,034 (GRCm39) missense probably damaging 1.00
R7432:Atg2b UTSW 12 105,630,957 (GRCm39) missense probably benign 0.08
R7630:Atg2b UTSW 12 105,613,213 (GRCm39) critical splice acceptor site probably null
R7634:Atg2b UTSW 12 105,618,379 (GRCm39) missense probably damaging 1.00
R7645:Atg2b UTSW 12 105,589,689 (GRCm39) missense probably benign 0.06
R7653:Atg2b UTSW 12 105,602,731 (GRCm39) missense possibly damaging 0.68
R8157:Atg2b UTSW 12 105,629,199 (GRCm39) missense probably damaging 1.00
R8222:Atg2b UTSW 12 105,618,475 (GRCm39) missense possibly damaging 0.95
R8469:Atg2b UTSW 12 105,604,170 (GRCm39) missense probably benign 0.00
R8708:Atg2b UTSW 12 105,635,687 (GRCm39) critical splice acceptor site probably benign
R8784:Atg2b UTSW 12 105,605,500 (GRCm39) missense probably damaging 1.00
R8975:Atg2b UTSW 12 105,602,725 (GRCm39) missense probably damaging 1.00
R8988:Atg2b UTSW 12 105,583,388 (GRCm39) missense probably damaging 0.97
R9071:Atg2b UTSW 12 105,625,099 (GRCm39) nonsense probably null
R9269:Atg2b UTSW 12 105,618,359 (GRCm39) missense probably damaging 1.00
R9355:Atg2b UTSW 12 105,636,980 (GRCm39) missense possibly damaging 0.48
R9402:Atg2b UTSW 12 105,614,682 (GRCm39) missense probably damaging 0.98
R9492:Atg2b UTSW 12 105,624,549 (GRCm39) missense probably benign 0.06
R9709:Atg2b UTSW 12 105,611,140 (GRCm39) missense probably damaging 1.00
R9717:Atg2b UTSW 12 105,605,561 (GRCm39) missense probably benign
R9746:Atg2b UTSW 12 105,630,197 (GRCm39) missense possibly damaging 0.84
X0018:Atg2b UTSW 12 105,632,956 (GRCm39) missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105,613,044 (GRCm39) missense probably benign 0.12
Z1177:Atg2b UTSW 12 105,602,023 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCAAAAGCGCGTATTTGG -3'
(R):5'- ACTTCAGGTACAAGAATCCTGC -3'

Sequencing Primer
(F):5'- ATCGTGTGAACAAGCTTCGGC -3'
(R):5'- TCAGGTACAAGAATCCTGCATGGC -3'
Posted On 2019-10-07