Incidental Mutation 'R7432:Nsd1'
ID576584
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Namenuclear receptor-binding SET-domain protein 1
SynonymsKMT3B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7432 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55209782-55318325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55213374 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 52 (T52A)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224156] [ENSMUST00000224693] [ENSMUST00000224918] [ENSMUST00000224973] [ENSMUST00000225169]
Predicted Effect probably benign
Transcript: ENSMUST00000099490
AA Change: T52A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: T52A

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224156
Predicted Effect probably benign
Transcript: ENSMUST00000224693
Predicted Effect probably benign
Transcript: ENSMUST00000224918
Predicted Effect probably benign
Transcript: ENSMUST00000224973
AA Change: T52A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225169
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,518,839 I31V probably benign Het
Adamts17 A G 7: 67,051,917 K40E Het
Akr1c14 G A 13: 4,088,952 D312N probably benign Het
Alg6 T C 4: 99,753,058 V398A probably benign Het
Ankmy1 A T 1: 92,896,079 M155K probably benign Het
Arid5b C A 10: 68,118,266 R396L probably damaging Het
Armt1 C A 10: 4,432,706 D12E probably benign Het
Arrb2 T A 11: 70,437,970 N217K probably benign Het
Atg2b A T 12: 105,661,204 L508Q probably damaging Het
Atg2b A T 12: 105,664,698 S323T probably benign Het
Atp1a3 G A 7: 25,005,875 probably benign Het
Atp6v0e T C 17: 26,682,698 V42A probably benign Het
Atp9b A G 18: 80,765,841 V621A Het
Atrnl1 A C 19: 57,755,524 D1186A probably damaging Het
Atxn2l A T 7: 126,493,874 M821K possibly damaging Het
Blnk G A 19: 40,959,857 R123* probably null Het
Bud13 T A 9: 46,287,074 S98T probably benign Het
Ccdc183 T C 2: 25,609,457 M455V probably benign Het
Cd109 A G 9: 78,714,943 Y1405C possibly damaging Het
Cdan1 A T 2: 120,722,755 L989Q probably damaging Het
Clec16a T C 16: 10,688,555 I713T possibly damaging Het
Clta T A 4: 44,032,419 F168L possibly damaging Het
Cnnm1 A T 19: 43,468,271 H583L probably benign Het
Cyp4f18 A G 8: 71,996,062 Y248H probably benign Het
Dsg4 G T 18: 20,446,266 G20* probably null Het
Dusp12 T A 1: 170,879,776 K248* probably null Het
Fam102b C T 3: 109,003,407 A51T probably damaging Het
Fhod3 A G 18: 25,001,909 D359G possibly damaging Het
Frmpd2 C A 14: 33,507,553 F365L probably damaging Het
Gab1 A G 8: 80,788,669 I340T probably benign Het
Gabpa C T 16: 84,857,520 Q362* probably null Het
Gcnt2 A T 13: 40,887,212 probably benign Het
Gm12728 T A 4: 105,794,289 L32Q probably damaging Het
Gpatch4 A G 3: 88,051,696 N35D probably damaging Het
Grid2 G T 6: 64,275,870 V441L possibly damaging Het
H2-M2 A G 17: 37,481,470 probably null Het
Hip1r T C 5: 123,991,766 F180L probably benign Het
Ikbkap C T 4: 56,776,925 G624D probably damaging Het
Il17re T C 6: 113,462,371 F81L probably benign Het
Il3ra T C 14: 14,350,691 V235A possibly damaging Het
Krtap6-2 C T 16: 89,419,873 G69S unknown Het
Lmln T C 16: 33,089,368 L373P probably damaging Het
Lmo7 C A 14: 101,902,115 Q945K probably benign Het
Loxhd1 G T 18: 77,295,851 V149L possibly damaging Het
Lrrc73 T C 17: 46,255,783 probably null Het
Mapkapk5 G A 5: 121,537,171 H112Y possibly damaging Het
Maz A G 7: 127,023,048 V467A probably benign Het
Med13l T G 5: 118,751,938 V1884G probably damaging Het
Nlrp12 A C 7: 3,222,539 N1033K probably benign Het
Nos3 T A 5: 24,367,615 V184E probably damaging Het
Npr2 T C 4: 43,647,155 V737A probably damaging Het
Obscn C T 11: 59,028,907 R108Q Het
Olfr1093 G T 2: 86,786,221 G164* probably null Het
Olfr1265 A T 2: 90,037,184 K88N probably damaging Het
Olfr1300-ps1 A G 2: 111,692,056 *179W probably null Het
Olfr153 T C 2: 87,532,440 S136P probably damaging Het
Olfr460 C A 6: 40,572,306 R307S probably benign Het
Olfr814 T C 10: 129,873,850 I302M probably benign Het
Ovol2 A G 2: 144,317,872 V116A probably benign Het
Pcdha5 C A 18: 36,962,326 S629R probably benign Het
Pde4dip T A 3: 97,695,092 M2274L probably benign Het
Pdpk1 T C 17: 24,101,669 T185A probably benign Het
Pip5k1a T G 3: 95,074,120 T67P probably benign Het
Plat G T 8: 22,773,651 V189F probably damaging Het
Ppm1a C T 12: 72,784,142 S147L probably damaging Het
Prim1 T A 10: 128,016,016 D52E probably damaging Het
Prkab1 C G 5: 116,024,162 D30H possibly damaging Het
Psma6 A T 12: 55,398,828 probably benign Het
Psmd2 T A 16: 20,654,925 M196K probably damaging Het
Ralgapa2 G T 2: 146,434,856 T488K probably benign Het
Rapgefl1 A G 11: 98,851,114 K635E probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rgs11 G A 17: 26,207,760 V289M probably damaging Het
Scmh1 T C 4: 120,529,156 L631P probably damaging Het
Sema3e T G 5: 14,224,390 D218E probably damaging Het
Sh3rf2 T C 18: 42,054,026 V70A probably damaging Het
Slc12a1 G T 2: 125,206,040 V801L probably benign Het
Slc25a51 C G 4: 45,399,765 A142P possibly damaging Het
Slc41a1 C T 1: 131,830,956 T112I probably damaging Het
Slc44a2 T C 9: 21,343,215 M264T probably benign Het
Snapc1 T A 12: 73,968,294 M134K probably benign Het
Snrk T C 9: 122,157,210 F215S probably damaging Het
Stab2 T C 10: 86,885,683 E1526G probably damaging Het
Tbc1d10a C A 11: 4,213,016 Y260* probably null Het
Tdrd5 A T 1: 156,302,432 L56Q probably damaging Het
Tenm2 T C 11: 36,864,941 T77A probably benign Het
Tmprss11g T G 5: 86,496,507 R159S possibly damaging Het
Traj38 T A 14: 54,180,577 N1K Het
Trove2 T C 1: 143,765,810 I304M probably benign Het
Ttn A G 2: 76,766,287 I20094T possibly damaging Het
Ubr4 T C 4: 139,388,382 L64P probably damaging Het
Utp20 C T 10: 88,798,398 R812Q probably benign Het
Vmn2r57 C A 7: 41,426,724 V455L probably benign Het
Wdcp T C 12: 4,850,246 V34A probably damaging Het
Zfp27 C T 7: 29,895,359 V394I probably benign Het
Zfp512b T C 2: 181,589,856 H177R probably benign Het
Zfp648 T A 1: 154,205,037 M314K possibly damaging Het
Zfp811 T C 17: 32,798,759 I102M possibly damaging Het
Zkscan6 A G 11: 65,814,363 probably null Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
Amanuensis UTSW 13 55261626 nonsense probably null
scribe UTSW 13 55291236 missense probably damaging 1.00
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7205:Nsd1 UTSW 13 55246470 missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
R7337:Nsd1 UTSW 13 55246209 missense probably damaging 1.00
R7638:Nsd1 UTSW 13 55312328 missense probably benign 0.01
R7647:Nsd1 UTSW 13 55299835 missense probably damaging 0.96
R7658:Nsd1 UTSW 13 55277639 missense probably damaging 1.00
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATGCAGGCACAGTATGGATC -3'
(R):5'- GTGGGCTCCTGTTTCATAGC -3'

Sequencing Primer
(F):5'- GCACAGTATGGATCGGACTTG -3'
(R):5'- CAATTGGCGACTGAGCTCTTGAATC -3'
Posted On2019-10-07