Incidental Mutation 'R7432:Dsg4'
ID 576600
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 045510-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R7432 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 20579323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Stop codon at position 20 (G20*)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably null
Transcript: ENSMUST00000019426
AA Change: G20*
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: G20*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,468,839 (GRCm39) I31V probably benign Het
Adamts17 A G 7: 66,701,665 (GRCm39) K40E Het
Akr1c14 G A 13: 4,138,952 (GRCm39) D312N probably benign Het
Alg6 T C 4: 99,641,295 (GRCm39) V398A probably benign Het
Ankmy1 A T 1: 92,823,801 (GRCm39) M155K probably benign Het
Arid5b C A 10: 67,954,096 (GRCm39) R396L probably damaging Het
Armt1 C A 10: 4,382,706 (GRCm39) D12E probably benign Het
Arrb2 T A 11: 70,328,796 (GRCm39) N217K probably benign Het
Atg2b A T 12: 105,627,463 (GRCm39) L508Q probably damaging Het
Atg2b A T 12: 105,630,957 (GRCm39) S323T probably benign Het
Atp1a3 G A 7: 24,705,300 (GRCm39) probably benign Het
Atp6v0e T C 17: 26,901,672 (GRCm39) V42A probably benign Het
Atp9b A G 18: 80,809,056 (GRCm39) V621A Het
Atrnl1 A C 19: 57,743,956 (GRCm39) D1186A probably damaging Het
Atxn2l A T 7: 126,093,046 (GRCm39) M821K possibly damaging Het
Blnk G A 19: 40,948,301 (GRCm39) R123* probably null Het
Bud13 T A 9: 46,198,372 (GRCm39) S98T probably benign Het
Ccdc183 T C 2: 25,499,469 (GRCm39) M455V probably benign Het
Cd109 A G 9: 78,622,225 (GRCm39) Y1405C possibly damaging Het
Cdan1 A T 2: 120,553,236 (GRCm39) L989Q probably damaging Het
Clec16a T C 16: 10,506,419 (GRCm39) I713T possibly damaging Het
Clta T A 4: 44,032,419 (GRCm39) F168L possibly damaging Het
Cnnm1 A T 19: 43,456,710 (GRCm39) H583L probably benign Het
Cyp4f18 A G 8: 72,749,906 (GRCm39) Y248H probably benign Het
Dusp12 T A 1: 170,707,345 (GRCm39) K248* probably null Het
Eeig2 C T 3: 108,910,723 (GRCm39) A51T probably damaging Het
Elp1 C T 4: 56,776,925 (GRCm39) G624D probably damaging Het
Fhod3 A G 18: 25,134,966 (GRCm39) D359G possibly damaging Het
Frmpd2 C A 14: 33,229,510 (GRCm39) F365L probably damaging Het
Gab1 A G 8: 81,515,298 (GRCm39) I340T probably benign Het
Gabpa C T 16: 84,654,408 (GRCm39) Q362* probably null Het
Gcnt2 A T 13: 41,040,688 (GRCm39) probably benign Het
Gm12728 T A 4: 105,651,486 (GRCm39) L32Q probably damaging Het
Gpatch4 A G 3: 87,959,003 (GRCm39) N35D probably damaging Het
Grid2 G T 6: 64,252,854 (GRCm39) V441L possibly damaging Het
H2-M2 A G 17: 37,792,361 (GRCm39) probably null Het
Hip1r T C 5: 124,129,829 (GRCm39) F180L probably benign Het
Il17re T C 6: 113,439,332 (GRCm39) F81L probably benign Het
Il3ra T C 14: 14,350,691 (GRCm38) V235A possibly damaging Het
Krtap6-2 C T 16: 89,216,761 (GRCm39) G69S unknown Het
Lmln T C 16: 32,909,738 (GRCm39) L373P probably damaging Het
Lmo7 C A 14: 102,139,551 (GRCm39) Q945K probably benign Het
Loxhd1 G T 18: 77,383,547 (GRCm39) V149L possibly damaging Het
Lrrc73 T C 17: 46,566,709 (GRCm39) probably null Het
Mapkapk5 G A 5: 121,675,234 (GRCm39) H112Y possibly damaging Het
Maz A G 7: 126,622,220 (GRCm39) V467A probably benign Het
Med13l T G 5: 118,890,003 (GRCm39) V1884G probably damaging Het
Nlrp12 A C 7: 3,271,213 (GRCm39) N1033K probably benign Het
Nos3 T A 5: 24,572,613 (GRCm39) V184E probably damaging Het
Npr2 T C 4: 43,647,155 (GRCm39) V737A probably damaging Het
Nsd1 A G 13: 55,361,187 (GRCm39) T52A probably benign Het
Obscn C T 11: 58,919,733 (GRCm39) R108Q Het
Or4k50-ps1 A G 2: 111,522,401 (GRCm39) *179W probably null Het
Or4x11 A T 2: 89,867,528 (GRCm39) K88N probably damaging Het
Or5t5 G T 2: 86,616,565 (GRCm39) G164* probably null Het
Or5w22 T C 2: 87,362,784 (GRCm39) S136P probably damaging Het
Or6c70 T C 10: 129,709,719 (GRCm39) I302M probably benign Het
Or9a4 C A 6: 40,549,240 (GRCm39) R307S probably benign Het
Ovol2 A G 2: 144,159,792 (GRCm39) V116A probably benign Het
Pcdha5 C A 18: 37,095,379 (GRCm39) S629R probably benign Het
Pde4dip T A 3: 97,602,408 (GRCm39) M2274L probably benign Het
Pdpk1 T C 17: 24,320,643 (GRCm39) T185A probably benign Het
Pip5k1a T G 3: 94,981,431 (GRCm39) T67P probably benign Het
Plat G T 8: 23,263,667 (GRCm39) V189F probably damaging Het
Ppm1a C T 12: 72,830,916 (GRCm39) S147L probably damaging Het
Prim1 T A 10: 127,851,885 (GRCm39) D52E probably damaging Het
Prkab1 C G 5: 116,162,221 (GRCm39) D30H possibly damaging Het
Psma6 A T 12: 55,445,613 (GRCm39) probably benign Het
Psmd2 T A 16: 20,473,675 (GRCm39) M196K probably damaging Het
Ralgapa2 G T 2: 146,276,776 (GRCm39) T488K probably benign Het
Rapgefl1 A G 11: 98,741,940 (GRCm39) K635E probably damaging Het
Rasgrp1 T C 2: 117,118,424 (GRCm39) I522V probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rgs11 G A 17: 26,426,734 (GRCm39) V289M probably damaging Het
Ro60 T C 1: 143,641,548 (GRCm39) I304M probably benign Het
Scmh1 T C 4: 120,386,353 (GRCm39) L631P probably damaging Het
Sema3e T G 5: 14,274,404 (GRCm39) D218E probably damaging Het
Sh3rf2 T C 18: 42,187,091 (GRCm39) V70A probably damaging Het
Slc12a1 G T 2: 125,047,960 (GRCm39) V801L probably benign Het
Slc25a51 C G 4: 45,399,765 (GRCm39) A142P possibly damaging Het
Slc41a1 C T 1: 131,758,694 (GRCm39) T112I probably damaging Het
Slc44a2 T C 9: 21,254,511 (GRCm39) M264T probably benign Het
Snapc1 T A 12: 74,015,068 (GRCm39) M134K probably benign Het
Snrk T C 9: 121,986,276 (GRCm39) F215S probably damaging Het
Stab2 T C 10: 86,721,547 (GRCm39) E1526G probably damaging Het
Tbc1d10a C A 11: 4,163,016 (GRCm39) Y260* probably null Het
Tdrd5 A T 1: 156,130,002 (GRCm39) L56Q probably damaging Het
Tenm2 T C 11: 36,755,768 (GRCm39) T77A probably benign Het
Tmprss11g T G 5: 86,644,366 (GRCm39) R159S possibly damaging Het
Traj38 T A 14: 54,418,034 (GRCm39) N1K Het
Ttn A G 2: 76,596,631 (GRCm39) I20094T possibly damaging Het
Ubr4 T C 4: 139,115,693 (GRCm39) L64P probably damaging Het
Utp20 C T 10: 88,634,260 (GRCm39) R812Q probably benign Het
Vmn2r57 C A 7: 41,076,148 (GRCm39) V455L probably benign Het
Wdcp T C 12: 4,900,246 (GRCm39) V34A probably damaging Het
Zfp27 C T 7: 29,594,784 (GRCm39) V394I probably benign Het
Zfp512b T C 2: 181,231,649 (GRCm39) H177R probably benign Het
Zfp648 T A 1: 154,080,783 (GRCm39) M314K possibly damaging Het
Zfp811 T C 17: 33,017,733 (GRCm39) I102M possibly damaging Het
Zkscan6 A G 11: 65,705,189 (GRCm39) probably null Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTCTTCTTCGGCTATGGAATAGTG -3'
(R):5'- TTTCAGTTAGGCCCAGGTTC -3'

Sequencing Primer
(F):5'- GAATCTTTCACTGAACCTGGAGC -3'
(R):5'- AGTTAGGCCCAGGTTCTGTCTTATAC -3'
Posted On 2019-10-07