Mutagenetix > Incidental Mutations

Incidental Mutation 'R7432:Dsg4'

576600

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

R7432 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 20446266 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 20 (G20*)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

Predicted Effect

probably null
Transcript: ENSMUST00000019426
AA Change: G20*

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: G20*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	C	11: 23,518,839	I31V	probably benign	Het
Adamts17	A	G	7: 67,051,917	K40E		Het
Akr1c14	G	A	13: 4,088,952	D312N	probably benign	Het
Alg6	T	C	4: 99,753,058	V398A	probably benign	Het
Ankmy1	A	T	1: 92,896,079	M155K	probably benign	Het
Arid5b	C	A	10: 68,118,266	R396L	probably damaging	Het
Armt1	C	A	10: 4,432,706	D12E	probably benign	Het
Arrb2	T	A	11: 70,437,970	N217K	probably benign	Het
Atg2b	A	T	12: 105,661,204	L508Q	probably damaging	Het
Atg2b	A	T	12: 105,664,698	S323T	probably benign	Het
Atp1a3	G	A	7: 25,005,875		probably benign	Het
Atp6v0e	T	C	17: 26,682,698	V42A	probably benign	Het
Atp9b	A	G	18: 80,765,841	V621A		Het
Atrnl1	A	C	19: 57,755,524	D1186A	probably damaging	Het
Atxn2l	A	T	7: 126,493,874	M821K	possibly damaging	Het
Blnk	G	A	19: 40,959,857	R123*	probably null	Het
Bud13	T	A	9: 46,287,074	S98T	probably benign	Het
Ccdc183	T	C	2: 25,609,457	M455V	probably benign	Het
Cd109	A	G	9: 78,714,943	Y1405C	possibly damaging	Het
Cdan1	A	T	2: 120,722,755	L989Q	probably damaging	Het
Clec16a	T	C	16: 10,688,555	I713T	possibly damaging	Het
Clta	T	A	4: 44,032,419	F168L	possibly damaging	Het
Cnnm1	A	T	19: 43,468,271	H583L	probably benign	Het
Cyp4f18	A	G	8: 71,996,062	Y248H	probably benign	Het
Dusp12	T	A	1: 170,879,776	K248*	probably null	Het
Fam102b	C	T	3: 109,003,407	A51T	probably damaging	Het
Fhod3	A	G	18: 25,001,909	D359G	possibly damaging	Het
Frmpd2	C	A	14: 33,507,553	F365L	probably damaging	Het
Gab1	A	G	8: 80,788,669	I340T	probably benign	Het
Gabpa	C	T	16: 84,857,520	Q362*	probably null	Het
Gcnt2	A	T	13: 40,887,212		probably benign	Het
Gm12728	T	A	4: 105,794,289	L32Q	probably damaging	Het
Gpatch4	A	G	3: 88,051,696	N35D	probably damaging	Het
Grid2	G	T	6: 64,275,870	V441L	possibly damaging	Het
H2-M2	A	G	17: 37,481,470		probably null	Het
Hip1r	T	C	5: 123,991,766	F180L	probably benign	Het
Ikbkap	C	T	4: 56,776,925	G624D	probably damaging	Het
Il17re	T	C	6: 113,462,371	F81L	probably benign	Het
Il3ra	T	C	14: 14,350,691	V235A	possibly damaging	Het
Krtap6-2	C	T	16: 89,419,873	G69S	unknown	Het
Lmln	T	C	16: 33,089,368	L373P	probably damaging	Het
Lmo7	C	A	14: 101,902,115	Q945K	probably benign	Het
Loxhd1	G	T	18: 77,295,851	V149L	possibly damaging	Het
Lrrc73	T	C	17: 46,255,783		probably null	Het
Mapkapk5	G	A	5: 121,537,171	H112Y	possibly damaging	Het
Maz	A	G	7: 127,023,048	V467A	probably benign	Het
Med13l	T	G	5: 118,751,938	V1884G	probably damaging	Het
Nlrp12	A	C	7: 3,222,539	N1033K	probably benign	Het
Nos3	T	A	5: 24,367,615	V184E	probably damaging	Het
Npr2	T	C	4: 43,647,155	V737A	probably damaging	Het
Nsd1	A	G	13: 55,213,374	T52A	probably benign	Het
Obscn	C	T	11: 59,028,907	R108Q		Het
Olfr1093	G	T	2: 86,786,221	G164*	probably null	Het
Olfr1265	A	T	2: 90,037,184	K88N	probably damaging	Het
Olfr1300-ps1	A	G	2: 111,692,056	*179W	probably null	Het
Olfr153	T	C	2: 87,532,440	S136P	probably damaging	Het
Olfr460	C	A	6: 40,572,306	R307S	probably benign	Het
Olfr814	T	C	10: 129,873,850	I302M	probably benign	Het
Ovol2	A	G	2: 144,317,872	V116A	probably benign	Het
Pcdha5	C	A	18: 36,962,326	S629R	probably benign	Het
Pde4dip	T	A	3: 97,695,092	M2274L	probably benign	Het
Pdpk1	T	C	17: 24,101,669	T185A	probably benign	Het
Pip5k1a	T	G	3: 95,074,120	T67P	probably benign	Het
Plat	G	T	8: 22,773,651	V189F	probably damaging	Het
Ppm1a	C	T	12: 72,784,142	S147L	probably damaging	Het
Prim1	T	A	10: 128,016,016	D52E	probably damaging	Het
Prkab1	C	G	5: 116,024,162	D30H	possibly damaging	Het
Psma6	A	T	12: 55,398,828		probably benign	Het
Psmd2	T	A	16: 20,654,925	M196K	probably damaging	Het
Ralgapa2	G	T	2: 146,434,856	T488K	probably benign	Het
Rapgefl1	A	G	11: 98,851,114	K635E	probably damaging	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rgs11	G	A	17: 26,207,760	V289M	probably damaging	Het
Scmh1	T	C	4: 120,529,156	L631P	probably damaging	Het
Sema3e	T	G	5: 14,224,390	D218E	probably damaging	Het
Sh3rf2	T	C	18: 42,054,026	V70A	probably damaging	Het
Slc12a1	G	T	2: 125,206,040	V801L	probably benign	Het
Slc25a51	C	G	4: 45,399,765	A142P	possibly damaging	Het
Slc41a1	C	T	1: 131,830,956	T112I	probably damaging	Het
Slc44a2	T	C	9: 21,343,215	M264T	probably benign	Het
Snapc1	T	A	12: 73,968,294	M134K	probably benign	Het
Snrk	T	C	9: 122,157,210	F215S	probably damaging	Het
Stab2	T	C	10: 86,885,683	E1526G	probably damaging	Het
Tbc1d10a	C	A	11: 4,213,016	Y260*	probably null	Het
Tdrd5	A	T	1: 156,302,432	L56Q	probably damaging	Het
Tenm2	T	C	11: 36,864,941	T77A	probably benign	Het
Tmprss11g	T	G	5: 86,496,507	R159S	possibly damaging	Het
Traj38	T	A	14: 54,180,577	N1K		Het
Trove2	T	C	1: 143,765,810	I304M	probably benign	Het
Ttn	A	G	2: 76,766,287	I20094T	possibly damaging	Het
Ubr4	T	C	4: 139,388,382	L64P	probably damaging	Het
Utp20	C	T	10: 88,798,398	R812Q	probably benign	Het
Vmn2r57	C	A	7: 41,426,724	V455L	probably benign	Het
Wdcp	T	C	12: 4,850,246	V34A	probably damaging	Het
Zfp27	C	T	7: 29,895,359	V394I	probably benign	Het
Zfp512b	T	C	2: 181,589,856	H177R	probably benign	Het
Zfp648	T	A	1: 154,205,037	M314K	possibly damaging	Het
Zfp811	T	C	17: 32,798,759	I102M	possibly damaging	Het
Zkscan6	A	G	11: 65,814,363		probably null	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCTTCTTCGGCTATGGAATAGTG -3'
(R):5'- TTTCAGTTAGGCCCAGGTTC -3'

Sequencing Primer
(F):5'- GAATCTTTCACTGAACCTGGAGC -3'
(R):5'- AGTTAGGCCCAGGTTCTGTCTTATAC -3'

Posted On

2019-10-07