Mutagenetix > Incidental Mutation

Incidental Mutation 'R7434:Ptpn18'

576609

Institutional Source

Beutler Lab

Gene Symbol

Ptpn18

Ensembl Gene

ENSMUSG00000026126

Gene Name

protein tyrosine phosphatase, non-receptor type 18

Synonyms

PTP-K1, FLP1, PTP-HSCF, HSCF, Ptpk1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R7434 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34459762-34475733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34473364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 417 (D417N)

Ref Sequence

ENSEMBL: ENSMUSP00000027302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]

AlphaFold

Q61152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027302
AA Change: D417N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: D417N

Domain	Start	End	E-Value	Type
PTPc	25	293	7.77e-115	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188972
AA Change: D68N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000190122

SMART Domains

Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

Domain	Start	End	E-Value	Type
PTPc	2	269	9.1e-113	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	C	T	7: 131,279,483	S1828F	unknown	Het
Adamtsl1	T	C	4: 86,425,878	V1731A	probably damaging	Het
BC025446	T	C	15: 75,216,718	F12L	probably benign	Het
Bcat2	A	G	7: 45,576,005		probably null	Het
Bcl6	T	G	16: 23,970,048	E523D	possibly damaging	Het
Col4a2	T	A	8: 11,421,250	N503K	probably damaging	Het
Cyb5r1	G	A	1: 134,407,838	C166Y	probably benign	Het
Cyp2w1	T	C	5: 139,357,020	V490A	possibly damaging	Het
Erich6b	A	G	14: 75,663,584	I113V	probably benign	Het
Fabp12	C	T	3: 10,247,678	V95I	probably benign	Het
Fam198b	T	A	3: 79,941,362	F472I	probably damaging	Het
Gpr3	T	C	4: 133,211,137	M75V	probably benign	Het
Grm5	T	G	7: 88,130,474	S1073A	probably benign	Het
Hoxc9	A	G	15: 102,983,982	K209R	probably damaging	Het
Irgm2	T	G	11: 58,219,465	V6G	probably benign	Het
Jakmip2	A	G	18: 43,557,379	V627A	possibly damaging	Het
Kansl1l	C	G	1: 66,762,103	S568T	probably damaging	Het
Lims1	A	G	10: 58,394,479	T21A	probably benign	Het
Lpar2	G	T	8: 69,826,515	A320S	probably benign	Het
Lpcat4	A	G	2: 112,243,055	N235S	probably damaging	Het
Meis1	A	T	11: 18,885,542	S359T	unknown	Het
Mtor	C	T	4: 148,464,959	T600I	probably benign	Het
Ncbp1	T	C	4: 46,149,910	S144P	probably damaging	Het
Ncor1	T	C	11: 62,383,199	E205G	probably damaging	Het
Nid1	T	C	13: 13,468,464	I329T	probably benign	Het
Nos3	T	C	5: 24,382,635	I1031T	probably damaging	Het
Nyap1	A	G	5: 137,736,268	S168P	probably damaging	Het
Olfr684	A	G	7: 105,156,899	V261A	probably damaging	Het
Pam	T	A	1: 97,975,790	K73*	probably null	Het
Pcdhga11	T	C	18: 37,757,952	V671A	probably benign	Het
Ric1	A	G	19: 29,574,780	D317G	probably damaging	Het
Scn1a	T	C	2: 66,273,045	E1957G	probably benign	Het
Srcap	T	C	7: 127,560,242	S3097P	unknown	Het
Tas2r113	C	T	6: 132,893,309	T100I	probably benign	Het
Tnni1	A	G	1: 135,807,522	D57G		Het
Trim29	G	A	9: 43,335,131	V575I	probably damaging	Het
Trpv3	G	A	11: 73,288,261	V499M	probably damaging	Het
Ubr1	C	T	2: 120,862,680	M1748I	probably benign	Het
Upk1a	A	T	7: 30,607,192	M99K	probably damaging	Het
Usp16	T	A	16: 87,479,319	L515*	probably null	Het
Vmn1r103	T	C	7: 20,510,510	K9E	probably damaging	Het
Vwde	A	G	6: 13,187,640	V616A	probably benign	Het
Zfp101	A	T	17: 33,381,590	S397R	possibly damaging	Het

Other mutations in Ptpn18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Ptpn18	APN	1	34463119	missense	probably damaging	0.98
IGL01611:Ptpn18	APN	1	34459817	utr 5 prime	probably benign
IGL01633:Ptpn18	APN	1	34471908	missense	probably benign	0.03
IGL03379:Ptpn18	APN	1	34470257	splice site	probably null
R0848:Ptpn18	UTSW	1	34462702	missense	probably damaging	1.00
R1400:Ptpn18	UTSW	1	34463506	critical splice donor site	probably null
R1973:Ptpn18	UTSW	1	34463109	missense	probably damaging	1.00
R2040:Ptpn18	UTSW	1	34470219	missense	probably damaging	0.99
R2113:Ptpn18	UTSW	1	34471661	missense	probably damaging	1.00
R2963:Ptpn18	UTSW	1	34471692	nonsense	probably null
R4061:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4062:Ptpn18	UTSW	1	34472930	missense	possibly damaging	0.66
R4509:Ptpn18	UTSW	1	34462742	missense	possibly damaging	0.49
R4522:Ptpn18	UTSW	1	34472960	missense	probably benign
R4626:Ptpn18	UTSW	1	34471792	splice site	probably null
R4978:Ptpn18	UTSW	1	34469813	intron	probably benign
R5260:Ptpn18	UTSW	1	34463510	splice site	probably benign
R5335:Ptpn18	UTSW	1	34463178	missense	probably damaging	1.00
R5481:Ptpn18	UTSW	1	34471663	missense	possibly damaging	0.67
R5865:Ptpn18	UTSW	1	34471563	splice site	probably benign
R7038:Ptpn18	UTSW	1	34459825	start codon destroyed	probably null	1.00
R7225:Ptpn18	UTSW	1	34472846	missense	possibly damaging	0.58
R7290:Ptpn18	UTSW	1	34462811	critical splice donor site	probably null
R7411:Ptpn18	UTSW	1	34472192	critical splice donor site	probably null
R7441:Ptpn18	UTSW	1	34473335	missense	probably benign	0.00
R7442:Ptpn18	UTSW	1	34462750	missense	probably benign	0.02
R7462:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7463:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7464:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7465:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7535:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7537:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7678:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7689:Ptpn18	UTSW	1	34473364	missense	possibly damaging	0.75
R7899:Ptpn18	UTSW	1	34469905	splice site	probably null
R8543:Ptpn18	UTSW	1	34472148	missense	probably benign	0.00
R8821:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8831:Ptpn18	UTSW	1	34472190	missense	probably null	1.00
R8858:Ptpn18	UTSW	1	34463115	missense	possibly damaging	0.88
R8879:Ptpn18	UTSW	1	34463130	missense	probably benign	0.23
R8924:Ptpn18	UTSW	1	34459885	missense	probably benign	0.02
R9657:Ptpn18	UTSW	1	34473392	missense	possibly damaging	0.87
X0065:Ptpn18	UTSW	1	34469891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGACCTCCGAACTTGGAC -3'
(R):5'- GCGCAAGTTGAAGCCTAAG -3'

Sequencing Primer
(F):5'- AACTTGGACACGCCCATGG -3'
(R):5'- GGCTCCATGCAGAAGCTAAG -3'

Posted On

2019-10-07