Incidental Mutation 'R7434:5430419D17Rik'
ID576632
Institutional Source Beutler Lab
Gene Symbol 5430419D17Rik
Ensembl Gene ENSMUSG00000006204
Gene NameRIKEN cDNA 5430419D17 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7434 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location131174402-131306451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131279483 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1828 (S1828F)
Ref Sequence ENSEMBL: ENSMUSP00000150784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124096] [ENSMUST00000208921]
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208921
AA Change: S1828F
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 T C 4: 86,425,878 V1731A probably damaging Het
BC025446 T C 15: 75,216,718 F12L probably benign Het
Bcl6 T G 16: 23,970,048 E523D possibly damaging Het
Col4a2 T A 8: 11,421,250 N503K probably damaging Het
Cyp2w1 T C 5: 139,357,020 V490A possibly damaging Het
Erich6b A G 14: 75,663,584 I113V probably benign Het
Fabp12 C T 3: 10,247,678 V95I probably benign Het
Fam198b T A 3: 79,941,362 F472I probably damaging Het
Gpr3 T C 4: 133,211,137 M75V probably benign Het
Grm5 T G 7: 88,130,474 S1073A probably benign Het
Hoxc9 A G 15: 102,983,982 K209R probably damaging Het
Irgm2 T G 11: 58,219,465 V6G probably benign Het
Jakmip2 A G 18: 43,557,379 V627A possibly damaging Het
Kansl1l C G 1: 66,762,103 S568T probably damaging Het
Lims1 A G 10: 58,394,479 T21A probably benign Het
Lpar2 G T 8: 69,826,515 A320S probably benign Het
Lpcat4 A G 2: 112,243,055 N235S probably damaging Het
Meis1 A T 11: 18,885,542 S359T unknown Het
Mtor C T 4: 148,464,959 T600I probably benign Het
Ncbp1 T C 4: 46,149,910 S144P probably damaging Het
Ncor1 T C 11: 62,383,199 E205G probably damaging Het
Nid1 T C 13: 13,468,464 I329T probably benign Het
Nos3 T C 5: 24,382,635 I1031T probably damaging Het
Nyap1 A G 5: 137,736,268 S168P probably damaging Het
Olfr684 A G 7: 105,156,899 V261A probably damaging Het
Pam T A 1: 97,975,790 K73* probably null Het
Pcdhga11 T C 18: 37,757,952 V671A probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ric1 A G 19: 29,574,780 D317G probably damaging Het
Scn1a T C 2: 66,273,045 E1957G probably benign Het
Srcap T C 7: 127,560,242 S3097P unknown Het
Tas2r113 C T 6: 132,893,309 T100I probably benign Het
Tnni1 A G 1: 135,807,522 D57G Het
Trim29 G A 9: 43,335,131 V575I probably damaging Het
Trpv3 G A 11: 73,288,261 V499M probably damaging Het
Ubr1 C T 2: 120,862,680 M1748I probably benign Het
Upk1a A T 7: 30,607,192 M99K probably damaging Het
Usp16 T A 16: 87,479,319 L515* probably null Het
Vmn1r103 T C 7: 20,510,510 K9E probably damaging Het
Vwde A G 6: 13,187,640 V616A probably benign Het
Zfp101 A T 17: 33,381,590 S397R possibly damaging Het
Other mutations in 5430419D17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:5430419D17Rik APN 7 131238094 unclassified probably null
IGL00848:5430419D17Rik APN 7 131246724 missense probably damaging 1.00
IGL00966:5430419D17Rik APN 7 131243107 nonsense probably null
IGL01286:5430419D17Rik APN 7 131246703 missense probably damaging 1.00
IGL01303:5430419D17Rik APN 7 131194331 missense possibly damaging 0.53
IGL01585:5430419D17Rik APN 7 131244758 missense probably damaging 0.97
IGL01665:5430419D17Rik APN 7 131246657 nonsense probably null
IGL01953:5430419D17Rik APN 7 131224980 missense probably benign 0.04
IGL02427:5430419D17Rik APN 7 131244788 missense probably damaging 0.99
IGL02508:5430419D17Rik APN 7 131222830 missense probably damaging 1.00
IGL02678:5430419D17Rik APN 7 131228917 missense probably damaging 1.00
IGL03092:5430419D17Rik APN 7 131201798 critical splice donor site probably null
IGL03122:5430419D17Rik APN 7 131196514 missense possibly damaging 0.68
IGL03343:5430419D17Rik APN 7 131246691 missense probably damaging 1.00
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0268:5430419D17Rik UTSW 7 131238176 missense probably damaging 1.00
R0383:5430419D17Rik UTSW 7 131239539 missense probably benign 0.05
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0974:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R1572:5430419D17Rik UTSW 7 131244831 nonsense probably null
R1911:5430419D17Rik UTSW 7 131238089 missense probably damaging 1.00
R2032:5430419D17Rik UTSW 7 131243052 missense probably damaging 1.00
R2097:5430419D17Rik UTSW 7 131181964 nonsense probably null
R2221:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2223:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2254:5430419D17Rik UTSW 7 131222905 missense probably damaging 1.00
R2913:5430419D17Rik UTSW 7 131182024 missense possibly damaging 0.90
R2991:5430419D17Rik UTSW 7 131246700 missense probably damaging 1.00
R3439:5430419D17Rik UTSW 7 131188779 critical splice donor site probably null
R4418:5430419D17Rik UTSW 7 131247465 missense possibly damaging 0.86
R4916:5430419D17Rik UTSW 7 131174477 synonymous probably null
R5488:5430419D17Rik UTSW 7 131246595 missense probably damaging 1.00
R5594:5430419D17Rik UTSW 7 131239523 missense probably benign 0.12
R5897:5430419D17Rik UTSW 7 131196551 splice site probably null
R5898:5430419D17Rik UTSW 7 131241967 splice site probably null
R5940:5430419D17Rik UTSW 7 131238263 missense probably damaging 1.00
R6170:5430419D17Rik UTSW 7 131174487 splice site probably null
R6187:5430419D17Rik UTSW 7 131270599 intron probably benign
R6321:5430419D17Rik UTSW 7 131257006 critical splice donor site probably null
R6409:5430419D17Rik UTSW 7 131262071 intron probably benign
R6432:5430419D17Rik UTSW 7 131244872 critical splice donor site probably null
R6481:5430419D17Rik UTSW 7 131256801 missense probably benign 0.05
R6750:5430419D17Rik UTSW 7 131288245 intron probably benign
R6783:5430419D17Rik UTSW 7 131226764 missense probably damaging 0.99
R6836:5430419D17Rik UTSW 7 131196504 missense possibly damaging 0.84
R6925:5430419D17Rik UTSW 7 131222707 missense possibly damaging 0.92
R6995:5430419D17Rik UTSW 7 131222671 missense probably damaging 1.00
R7199:5430419D17Rik UTSW 7 131235912 nonsense probably null
R7205:5430419D17Rik UTSW 7 131277623 critical splice donor site probably null
R7340:5430419D17Rik UTSW 7 131277615 missense unknown
R7354:5430419D17Rik UTSW 7 131256729 missense possibly damaging 0.84
R7354:5430419D17Rik UTSW 7 131272033 missense unknown
R7485:5430419D17Rik UTSW 7 131228833 missense probably damaging 0.99
R7513:5430419D17Rik UTSW 7 131272071 missense unknown
R7562:5430419D17Rik UTSW 7 131302697 missense unknown
Z1088:5430419D17Rik UTSW 7 131246633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGGTAACAACTCTTGCTC -3'
(R):5'- TTCTGCTGAGACTGAAGATGCAC -3'

Sequencing Primer
(F):5'- AGGTAACAACTCTTGCTCTGGATTTG -3'
(R):5'- CTGAAGATGCACCTGTGTAGAAACC -3'
Posted On2019-10-07