Incidental Mutation 'R7434:BC025446'
ID576643
Institutional Source Beutler Lab
Gene Symbol BC025446
Ensembl Gene ENSMUSG00000047728
Gene NamecDNA sequence BC025446
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7434 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location75216376-75222661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75216718 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000053396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055719] [ENSMUST00000185307] [ENSMUST00000229521]
Predicted Effect probably benign
Transcript: ENSMUST00000055719
AA Change: F12L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053396
Gene: ENSMUSG00000047728
AA Change: F12L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.06e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185307
AA Change: F12L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140330
Gene: ENSMUSG00000047728
AA Change: F12L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 5.3e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229521
AA Change: F12L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C T 7: 131,279,483 S1828F unknown Het
Adamtsl1 T C 4: 86,425,878 V1731A probably damaging Het
Bcat2 A G 7: 45,576,005 probably null Het
Bcl6 T G 16: 23,970,048 E523D possibly damaging Het
Col4a2 T A 8: 11,421,250 N503K probably damaging Het
Cyb5r1 G A 1: 134,407,838 C166Y probably benign Het
Cyp2w1 T C 5: 139,357,020 V490A possibly damaging Het
Erich6b A G 14: 75,663,584 I113V probably benign Het
Fabp12 C T 3: 10,247,678 V95I probably benign Het
Fam198b T A 3: 79,941,362 F472I probably damaging Het
Gpr3 T C 4: 133,211,137 M75V probably benign Het
Grm5 T G 7: 88,130,474 S1073A probably benign Het
Hoxc9 A G 15: 102,983,982 K209R probably damaging Het
Irgm2 T G 11: 58,219,465 V6G probably benign Het
Jakmip2 A G 18: 43,557,379 V627A possibly damaging Het
Kansl1l C G 1: 66,762,103 S568T probably damaging Het
Lims1 A G 10: 58,394,479 T21A probably benign Het
Lpar2 G T 8: 69,826,515 A320S probably benign Het
Lpcat4 A G 2: 112,243,055 N235S probably damaging Het
Meis1 A T 11: 18,885,542 S359T unknown Het
Mtor C T 4: 148,464,959 T600I probably benign Het
Ncbp1 T C 4: 46,149,910 S144P probably damaging Het
Ncor1 T C 11: 62,383,199 E205G probably damaging Het
Nid1 T C 13: 13,468,464 I329T probably benign Het
Nos3 T C 5: 24,382,635 I1031T probably damaging Het
Nyap1 A G 5: 137,736,268 S168P probably damaging Het
Olfr684 A G 7: 105,156,899 V261A probably damaging Het
Pam T A 1: 97,975,790 K73* probably null Het
Pcdhga11 T C 18: 37,757,952 V671A probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ric1 A G 19: 29,574,780 D317G probably damaging Het
Scn1a T C 2: 66,273,045 E1957G probably benign Het
Srcap T C 7: 127,560,242 S3097P unknown Het
Tas2r113 C T 6: 132,893,309 T100I probably benign Het
Tnni1 A G 1: 135,807,522 D57G Het
Trim29 G A 9: 43,335,131 V575I probably damaging Het
Trpv3 G A 11: 73,288,261 V499M probably damaging Het
Ubr1 C T 2: 120,862,680 M1748I probably benign Het
Upk1a A T 7: 30,607,192 M99K probably damaging Het
Usp16 T A 16: 87,479,319 L515* probably null Het
Vmn1r103 T C 7: 20,510,510 K9E probably damaging Het
Vwde A G 6: 13,187,640 V616A probably benign Het
Zfp101 A T 17: 33,381,590 S397R possibly damaging Het
Other mutations in BC025446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:BC025446 APN 15 75221656 utr 3 prime probably benign
R0084:BC025446 UTSW 15 75217775 missense probably benign 0.01
R0764:BC025446 UTSW 15 75220723 missense probably benign
R1736:BC025446 UTSW 15 75217720 missense probably damaging 1.00
R1829:BC025446 UTSW 15 75216756 critical splice donor site probably null
R5412:BC025446 UTSW 15 75217820 missense probably damaging 0.98
R5793:BC025446 UTSW 15 75221644 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CATGTATTCCTTGGTGAAAGCTG -3'
(R):5'- TTGTTGCAAAGCAGGGTCTG -3'

Sequencing Primer
(F):5'- ATTCCTTGGTGAAAGCTGTGTGG -3'
(R):5'- AGCACAGGAGGCTTCACC -3'
Posted On2019-10-07