Incidental Mutation 'R7434:Ric1'
ID576650
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R7434 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29574780 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 317 (D317G)
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610]
Predicted Effect probably damaging
Transcript: ENSMUST00000043610
AA Change: D317G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: D317G

DomainStartEndE-ValueType
Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: D245G

DomainStartEndE-ValueType
Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.7452 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C T 7: 131,279,483 S1828F unknown Het
Adamtsl1 T C 4: 86,425,878 V1731A probably damaging Het
BC025446 T C 15: 75,216,718 F12L probably benign Het
Bcat2 A G 7: 45,576,005 probably null Het
Bcl6 T G 16: 23,970,048 E523D possibly damaging Het
Col4a2 T A 8: 11,421,250 N503K probably damaging Het
Cyb5r1 G A 1: 134,407,838 C166Y probably benign Het
Cyp2w1 T C 5: 139,357,020 V490A possibly damaging Het
Erich6b A G 14: 75,663,584 I113V probably benign Het
Fabp12 C T 3: 10,247,678 V95I probably benign Het
Fam198b T A 3: 79,941,362 F472I probably damaging Het
Gpr3 T C 4: 133,211,137 M75V probably benign Het
Grm5 T G 7: 88,130,474 S1073A probably benign Het
Hoxc9 A G 15: 102,983,982 K209R probably damaging Het
Irgm2 T G 11: 58,219,465 V6G probably benign Het
Jakmip2 A G 18: 43,557,379 V627A possibly damaging Het
Kansl1l C G 1: 66,762,103 S568T probably damaging Het
Lims1 A G 10: 58,394,479 T21A probably benign Het
Lpar2 G T 8: 69,826,515 A320S probably benign Het
Lpcat4 A G 2: 112,243,055 N235S probably damaging Het
Meis1 A T 11: 18,885,542 S359T unknown Het
Mtor C T 4: 148,464,959 T600I probably benign Het
Ncbp1 T C 4: 46,149,910 S144P probably damaging Het
Ncor1 T C 11: 62,383,199 E205G probably damaging Het
Nid1 T C 13: 13,468,464 I329T probably benign Het
Nos3 T C 5: 24,382,635 I1031T probably damaging Het
Nyap1 A G 5: 137,736,268 S168P probably damaging Het
Olfr684 A G 7: 105,156,899 V261A probably damaging Het
Pam T A 1: 97,975,790 K73* probably null Het
Pcdhga11 T C 18: 37,757,952 V671A probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Scn1a T C 2: 66,273,045 E1957G probably benign Het
Srcap T C 7: 127,560,242 S3097P unknown Het
Tas2r113 C T 6: 132,893,309 T100I probably benign Het
Tnni1 A G 1: 135,807,522 D57G Het
Trim29 G A 9: 43,335,131 V575I probably damaging Het
Trpv3 G A 11: 73,288,261 V499M probably damaging Het
Ubr1 C T 2: 120,862,680 M1748I probably benign Het
Upk1a A T 7: 30,607,192 M99K probably damaging Het
Usp16 T A 16: 87,479,319 L515* probably null Het
Vmn1r103 T C 7: 20,510,510 K9E probably damaging Het
Vwde A G 6: 13,187,640 V616A probably benign Het
Zfp101 A T 17: 33,381,590 S397R possibly damaging Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0336:Ric1 UTSW 19 29587793 missense probably damaging 0.96
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4004:Ric1 UTSW 19 29579801 missense probably benign 0.44
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4283:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R5965:Ric1 UTSW 19 29570771 missense probably damaging 0.99
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6345:Ric1 UTSW 19 29604085 missense probably benign 0.09
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7296:Ric1 UTSW 19 29584578 critical splice donor site probably null
R7619:Ric1 UTSW 19 29579775 missense probably benign 0.32
R7850:Ric1 UTSW 19 29594893 missense probably benign
R7933:Ric1 UTSW 19 29594893 missense probably benign
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGCCTTAGTTTTCAGTACC -3'
(R):5'- TGTCAGGGAAACAATGGGTC -3'

Sequencing Primer
(F):5'- CACAGACGGGTTCATCCTAGTTAG -3'
(R):5'- TCAGGGAAACAATGGGTCACTTATC -3'
Posted On2019-10-07