Mutagenetix > Incidental Mutation

Incidental Mutation 'R7437:Adamtsl2'

576654

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27089709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 297 (I297V)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably damaging
Transcript: ENSMUST00000091233
AA Change: I297V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: I297V

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	T	17: 24,400,498	I1192F	probably damaging	Het
Abca8a	A	G	11: 110,050,964	S1160P	probably benign	Het
Aebp1	T	A	11: 5,869,757	F687L	possibly damaging	Het
Ahsa1	A	G	12: 87,268,156	T28A	probably damaging	Het
Akap3	A	T	6: 126,865,655	K412N	probably damaging	Het
Atl1	A	G	12: 69,931,622	I123V	probably benign	Het
Atp10a	G	A	7: 58,658,540	R29H	unknown	Het
C4b	T	C	17: 34,734,733	D967G	probably benign	Het
Ccdc186	T	C	19: 56,806,997	N416S	probably damaging	Het
Ccna2	T	C	3: 36,571,090		probably benign	Het
Cep70	T	C	9: 99,291,529	L371P	probably damaging	Het
Cfap46	A	T	7: 139,650,837	C958*	probably null	Het
Crlf2	T	C	5: 109,554,973	D318G	probably benign	Het
Csf1	T	C	3: 107,750,756	N14D	probably benign	Het
Dars	A	G	1: 128,372,204	Y348H	possibly damaging	Het
Dnah2	T	C	11: 69,498,627	E813G	probably damaging	Het
Ebi3	T	A	17: 55,954,410	M102K	probably benign	Het
Epg5	A	G	18: 78,023,278	D2131G	probably benign	Het
Fam186a	A	T	15: 99,942,894	L1823H	probably damaging	Het
Fam213b	C	A	4: 154,896,596	C194F	possibly damaging	Het
H2-M3	T	C	17: 37,272,678	M309T	probably benign	Het
Ift122	C	T	6: 115,926,302	R1176C	probably benign	Het
Ino80	A	G	2: 119,442,586	S470P	possibly damaging	Het
Kcnh5	C	T	12: 75,137,643		probably null	Het
Kif24	T	C	4: 41,404,687	T438A	possibly damaging	Het
Kndc1	G	A	7: 139,909,043	G205R	probably damaging	Het
Lrp1b	A	T	2: 40,822,645	Y3226N		Het
Lrp1b	G	T	2: 40,822,646	D3225E		Het
Megf10	G	C	18: 57,262,131	G522R	probably damaging	Het
Mgea5	A	T	19: 45,778,607	M110K	possibly damaging	Het
Nectin2	A	T	7: 19,749,268	L12*	probably null	Het
Ngef	A	T	1: 87,480,605	M580K	probably damaging	Het
Olfr1118	A	G	2: 87,309,343	M205V	probably benign	Het
Olfr1437	T	C	19: 12,322,108	N240D	probably damaging	Het
Olfr376	A	G	11: 73,375,018	S93G	probably benign	Het
Pcdhb13	T	C	18: 37,444,675	L702P	probably damaging	Het
Pcdhb17	A	G	18: 37,486,092	I312V	probably benign	Het
Pglyrp3	A	G	3: 92,030,678	N265D	probably benign	Het
Pkd1l2	A	G	8: 117,030,682	V1539A	probably damaging	Het
Rcn2	T	C	9: 56,058,069	L274P	probably damaging	Het
Rpp30	A	G	19: 36,104,438	E267G	possibly damaging	Het
Rundc3a	A	G	11: 102,398,404	M134V	probably damaging	Het
Samd3	A	T	10: 26,270,106	Q343L	possibly damaging	Het
Serpinb3c	A	T	1: 107,271,714	F359Y	probably damaging	Het
Slc9a9	T	C	9: 95,228,941	L604P	probably benign	Het
Strn3	A	T	12: 51,610,163	H777Q	probably damaging	Het
Tap1	G	A	17: 34,190,642	W284*	probably null	Het
Tmem136	C	T	9: 43,111,785	W91*	probably null	Het
Tmem181a	A	G	17: 6,303,265	D384G	possibly damaging	Het
Txndc12	T	C	4: 108,856,171	S77P	probably damaging	Het
Wnt16	G	A	6: 22,288,561	V19M	probably benign	Het
Zfp932	T	A	5: 110,010,014	M526K	probably benign	Het
Zfp959	G	T	17: 55,898,334	C457F	probably damaging	Het
Zscan4-ps3	T	C	7: 11,612,936	S300P	probably benign	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
R9284:Adamtsl2	UTSW	2	27104043	splice site	probably benign
R9566:Adamtsl2	UTSW	2	27089761	critical splice donor site	probably null
R9772:Adamtsl2	UTSW	2	27095654	missense	probably benign
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGAGCCTGTATGCTGACTC -3'
(R):5'- TGATCACAGAATGGGATGGC -3'

Sequencing Primer
(F):5'- TGTATGCTGACTCCTCCCTG -3'
(R):5'- CAACAGTTCTGAATGGATGGATG -3'

Posted On

2019-10-07