Incidental Mutation 'R7437:Olfr1118'
ID576657
Institutional Source Beutler Lab
Gene Symbol Olfr1118
Ensembl Gene ENSMUSG00000083706
Gene Nameolfactory receptor 1118
SynonymsMOR264-22, Olfr1118-ps, GA_x6K02T2Q125-48795705-48796673
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87307581-87313621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87309343 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 205 (M205V)
Ref Sequence ENSEMBL: ENSMUSP00000150394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121296] [ENSMUST00000216396]
Predicted Effect probably benign
Transcript: ENSMUST00000121296
AA Change: M185V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144143
Gene: ENSMUSG00000083706
AA Change: M185V

DomainStartEndE-ValueType
Pfam:7tm_4 22 298 1.2e-51 PFAM
Pfam:7tm_1 32 281 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216396
AA Change: M205V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Olfr1118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1118 APN 2 87309581 missense possibly damaging 0.95
IGL01458:Olfr1118 APN 2 87309482 missense probably damaging 1.00
IGL02544:Olfr1118 APN 2 87309127 missense possibly damaging 0.91
IGL02748:Olfr1118 APN 2 87309665 missense probably damaging 1.00
IGL03077:Olfr1118 APN 2 87309712 makesense probably null
R0411:Olfr1118 UTSW 2 87309058 missense probably benign 0.07
R0525:Olfr1118 UTSW 2 87309349 missense probably benign 0.10
R1703:Olfr1118 UTSW 2 87309410 missense probably benign 0.00
R1750:Olfr1118 UTSW 2 87308852 missense probably benign 0.02
R2005:Olfr1118 UTSW 2 87309448 missense probably benign 0.24
R2090:Olfr1118 UTSW 2 87309418 missense probably benign 0.02
R3846:Olfr1118 UTSW 2 87309182 missense probably benign 0.15
R4011:Olfr1118 UTSW 2 87309211 missense probably benign 0.03
R4077:Olfr1118 UTSW 2 87308864 unclassified probably null 0.42
R5132:Olfr1118 UTSW 2 87308938 missense probably damaging 1.00
R5368:Olfr1118 UTSW 2 87308782 unclassified probably null
R7355:Olfr1118 UTSW 2 87309410 missense probably benign 0.00
R7405:Olfr1118 UTSW 2 87308995 missense probably benign 0.00
R7554:Olfr1118 UTSW 2 87309005 missense probably damaging 1.00
R7609:Olfr1118 UTSW 2 87309509 missense probably benign 0.01
RF010:Olfr1118 UTSW 2 87308840 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCAGCTATGGCCTATGATCG -3'
(R):5'- AACAAGACTACAACTATCAGGTGG -3'

Sequencing Primer
(F):5'- CAGCTATGGCCTATGATCGTTATG -3'
(R):5'- CTACAACTATCAGGTGGGATGAGC -3'
Posted On2019-10-07