Mutagenetix > Incidental Mutations

Incidental Mutation 'R7437:Olfr1118'

576657

Institutional Source

Beutler Lab

Gene Symbol

Olfr1118

Ensembl Gene

ENSMUSG00000083706

Gene Name

olfactory receptor 1118

Synonyms

MOR264-22, Olfr1118-ps, GA_x6K02T2Q125-48795705-48796673

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R7437 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87307581-87313621 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87309343 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 205 (M205V)

Ref Sequence

ENSEMBL: ENSMUSP00000150394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121296] [ENSMUST00000216396]

Predicted Effect

probably benign
Transcript: ENSMUST00000121296
AA Change: M185V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144143
Gene: ENSMUSG00000083706
AA Change: M185V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	22	298	1.2e-51	PFAM
Pfam:7tm_1	32	281	7.2e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216396
AA Change: M205V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	T	17: 24,400,498	I1192F	probably damaging	Het
Abca8a	A	G	11: 110,050,964	S1160P	probably benign	Het
Adamtsl2	A	G	2: 27,089,709	I297V	probably damaging	Het
Aebp1	T	A	11: 5,869,757	F687L	possibly damaging	Het
Ahsa1	A	G	12: 87,268,156	T28A	probably damaging	Het
Akap3	A	T	6: 126,865,655	K412N	probably damaging	Het
Atl1	A	G	12: 69,931,622	I123V	probably benign	Het
Atp10a	G	A	7: 58,658,540	R29H	unknown	Het
C4b	T	C	17: 34,734,733	D967G	probably benign	Het
Ccdc186	T	C	19: 56,806,997	N416S	probably damaging	Het
Ccna2	T	C	3: 36,571,090		probably benign	Het
Cep70	T	C	9: 99,291,529	L371P	probably damaging	Het
Cfap46	A	T	7: 139,650,837	C958*	probably null	Het
Crlf2	T	C	5: 109,554,973	D318G	probably benign	Het
Csf1	T	C	3: 107,750,756	N14D	probably benign	Het
Dars	A	G	1: 128,372,204	Y348H	possibly damaging	Het
Dnah2	T	C	11: 69,498,627	E813G	probably damaging	Het
Ebi3	T	A	17: 55,954,410	M102K	probably benign	Het
Epg5	A	G	18: 78,023,278	D2131G	probably benign	Het
Fam186a	A	T	15: 99,942,894	L1823H	probably damaging	Het
Fam213b	C	A	4: 154,896,596	C194F	possibly damaging	Het
H2-M3	T	C	17: 37,272,678	M309T	probably benign	Het
Ift122	C	T	6: 115,926,302	R1176C	probably benign	Het
Ino80	A	G	2: 119,442,586	S470P	possibly damaging	Het
Kcnh5	C	T	12: 75,137,643		probably null	Het
Kif24	T	C	4: 41,404,687	T438A	possibly damaging	Het
Kndc1	G	A	7: 139,909,043	G205R	probably damaging	Het
Lrp1b	A	T	2: 40,822,645	Y3226N		Het
Lrp1b	G	T	2: 40,822,646	D3225E		Het
Megf10	G	C	18: 57,262,131	G522R	probably damaging	Het
Mgea5	A	T	19: 45,778,607	M110K	possibly damaging	Het
Nectin2	A	T	7: 19,749,268	L12*	probably null	Het
Ngef	A	T	1: 87,480,605	M580K	probably damaging	Het
Olfr1437	T	C	19: 12,322,108	N240D	probably damaging	Het
Olfr376	A	G	11: 73,375,018	S93G	probably benign	Het
Pcdhb13	T	C	18: 37,444,675	L702P	probably damaging	Het
Pcdhb17	A	G	18: 37,486,092	I312V	probably benign	Het
Pglyrp3	A	G	3: 92,030,678	N265D	probably benign	Het
Pkd1l2	A	G	8: 117,030,682	V1539A	probably damaging	Het
Rcn2	T	C	9: 56,058,069	L274P	probably damaging	Het
Rpp30	A	G	19: 36,104,438	E267G	possibly damaging	Het
Rundc3a	A	G	11: 102,398,404	M134V	probably damaging	Het
Samd3	A	T	10: 26,270,106	Q343L	possibly damaging	Het
Serpinb3c	A	T	1: 107,271,714	F359Y	probably damaging	Het
Slc9a9	T	C	9: 95,228,941	L604P	probably benign	Het
Strn3	A	T	12: 51,610,163	H777Q	probably damaging	Het
Tap1	G	A	17: 34,190,642	W284*	probably null	Het
Tmem136	C	T	9: 43,111,785	W91*	probably null	Het
Tmem181a	A	G	17: 6,303,265	D384G	possibly damaging	Het
Txndc12	T	C	4: 108,856,171	S77P	probably damaging	Het
Wnt16	G	A	6: 22,288,561	V19M	probably benign	Het
Zfp932	T	A	5: 110,010,014	M526K	probably benign	Het
Zfp959	G	T	17: 55,898,334	C457F	probably damaging	Het
Zscan4-ps3	T	C	7: 11,612,936	S300P	probably benign	Het

Other mutations in Olfr1118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01328:Olfr1118	APN	2	87309581	missense	possibly damaging	0.95
IGL01458:Olfr1118	APN	2	87309482	missense	probably damaging	1.00
IGL02544:Olfr1118	APN	2	87309127	missense	possibly damaging	0.91
IGL02748:Olfr1118	APN	2	87309665	missense	probably damaging	1.00
IGL03077:Olfr1118	APN	2	87309712	makesense	probably null
R0411:Olfr1118	UTSW	2	87309058	missense	probably benign	0.07
R0525:Olfr1118	UTSW	2	87309349	missense	probably benign	0.10
R1703:Olfr1118	UTSW	2	87309410	missense	probably benign	0.00
R1750:Olfr1118	UTSW	2	87308852	missense	probably benign	0.02
R2005:Olfr1118	UTSW	2	87309448	missense	probably benign	0.24
R2090:Olfr1118	UTSW	2	87309418	missense	probably benign	0.02
R3846:Olfr1118	UTSW	2	87309182	missense	probably benign	0.15
R4011:Olfr1118	UTSW	2	87309211	missense	probably benign	0.03
R4077:Olfr1118	UTSW	2	87308864	unclassified	probably null	0.42
R5132:Olfr1118	UTSW	2	87308938	missense	probably damaging	1.00
R5368:Olfr1118	UTSW	2	87308782	unclassified	probably null
R7355:Olfr1118	UTSW	2	87309410	missense	probably benign	0.00
R7405:Olfr1118	UTSW	2	87308995	missense	probably benign	0.00
R7554:Olfr1118	UTSW	2	87309005	missense	probably damaging	1.00
R7609:Olfr1118	UTSW	2	87309509	missense	probably benign	0.01
RF010:Olfr1118	UTSW	2	87308840	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCAGCTATGGCCTATGATCG -3'
(R):5'- AACAAGACTACAACTATCAGGTGG -3'

Sequencing Primer
(F):5'- CAGCTATGGCCTATGATCGTTATG -3'
(R):5'- CTACAACTATCAGGTGGGATGAGC -3'

Posted On

2019-10-07