Incidental Mutation 'R7437:Kif24'
ID576662
Institutional Source Beutler Lab
Gene Symbol Kif24
Ensembl Gene ENSMUSG00000028438
Gene Namekinesin family member 24
Synonyms4933425J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41390745-41464887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41404687 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 438 (T438A)
Ref Sequence ENSEMBL: ENSMUSP00000103690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000108055]
Predicted Effect probably benign
Transcript: ENSMUST00000030148
AA Change: T304A

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438
AA Change: T304A

DomainStartEndE-ValueType
KISc 216 413 2.51e-29 SMART
low complexity region 481 499 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 626 644 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108055
AA Change: T438A

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438
AA Change: T438A

DomainStartEndE-ValueType
Blast:KISc 82 205 1e-47 BLAST
KISc 216 547 3.09e-134 SMART
low complexity region 615 633 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 812 829 N/A INTRINSIC
low complexity region 1253 1264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Kif24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif24 APN 4 41413826 splice site probably null
IGL00787:Kif24 APN 4 41397583 missense probably damaging 1.00
IGL01065:Kif24 APN 4 41423639 unclassified probably benign
IGL01716:Kif24 APN 4 41393454 missense probably benign 0.40
IGL01796:Kif24 APN 4 41392978 unclassified probably benign
IGL02307:Kif24 APN 4 41395274 missense probably benign 0.02
IGL03061:Kif24 APN 4 41394323 missense possibly damaging 0.86
IGL03080:Kif24 APN 4 41394417 missense probably benign 0.12
IGL03100:Kif24 APN 4 41394446 missense possibly damaging 0.59
R0226:Kif24 UTSW 4 41414939 nonsense probably null
R0345:Kif24 UTSW 4 41428413 missense probably benign 0.01
R0365:Kif24 UTSW 4 41428731 missense probably benign 0.06
R0366:Kif24 UTSW 4 41428717 missense possibly damaging 0.77
R0579:Kif24 UTSW 4 41393706 missense probably damaging 0.97
R0682:Kif24 UTSW 4 41428620 missense probably benign 0.01
R1611:Kif24 UTSW 4 41423552 missense probably benign 0.02
R1634:Kif24 UTSW 4 41393529 missense probably benign 0.02
R1772:Kif24 UTSW 4 41409787 missense probably damaging 1.00
R1997:Kif24 UTSW 4 41392904 missense possibly damaging 0.92
R3833:Kif24 UTSW 4 41395064 missense probably damaging 1.00
R3849:Kif24 UTSW 4 41404734 missense probably damaging 1.00
R4356:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4357:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4358:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4359:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4406:Kif24 UTSW 4 41393954 missense probably damaging 1.00
R4580:Kif24 UTSW 4 41395287 missense probably damaging 1.00
R4756:Kif24 UTSW 4 41397545 critical splice donor site probably null
R4921:Kif24 UTSW 4 41394329 missense probably damaging 0.99
R4935:Kif24 UTSW 4 41394939 missense probably damaging 0.99
R5288:Kif24 UTSW 4 41395373 missense probably benign 0.09
R5398:Kif24 UTSW 4 41394401 missense possibly damaging 0.50
R5885:Kif24 UTSW 4 41423463 missense probably damaging 1.00
R5901:Kif24 UTSW 4 41428604 missense probably damaging 1.00
R5919:Kif24 UTSW 4 41394477 missense possibly damaging 0.62
R5945:Kif24 UTSW 4 41428670 nonsense probably null
R6278:Kif24 UTSW 4 41423498 missense probably damaging 1.00
R6291:Kif24 UTSW 4 41413959 missense probably damaging 1.00
R6891:Kif24 UTSW 4 41394168 missense probably benign 0.33
R7178:Kif24 UTSW 4 41395085 missense probably benign 0.00
R7453:Kif24 UTSW 4 41394673 missense possibly damaging 0.91
R7543:Kif24 UTSW 4 41413993 nonsense probably null
R7548:Kif24 UTSW 4 41423601 missense possibly damaging 0.57
Z1088:Kif24 UTSW 4 41395091 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAACAATAGGTCATTACTTCATGG -3'
(R):5'- ATGCCAGGTCTCTACTGCTTAC -3'

Sequencing Primer
(F):5'- CATGGTTAATCAACTGATGGCAC -3'
(R):5'- CAGGTGATCTTAAAGGGC -3'
Posted On2019-10-07