Incidental Mutation 'R7437:Txndc12'
ID576663
Institutional Source Beutler Lab
Gene Symbol Txndc12
Ensembl Gene ENSMUSG00000028567
Gene Namethioredoxin domain containing 12 (endoplasmic reticulum)
SynonymsERp16, 0610040B21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108834601-108862127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108856171 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 77 (S77P)
Ref Sequence ENSEMBL: ENSMUSP00000030296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296]
Predicted Effect probably damaging
Transcript: ENSMUST00000030296
AA Change: S77P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567
AA Change: S77P

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Meta Mutation Damage Score 0.5355 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. This protein localizes to the endoplasmic reticulum and has a single atypical active motif. The encoded protein is mainly involved in catalyzing native disulfide bond formation and displays activity similar to protein-disulfide isomerases. This protein may play a role in defense against endoplasmic reticulum stress. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Txndc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Txndc12 APN 4 108834792 nonsense probably null
IGL02933:Txndc12 APN 4 108857996 critical splice donor site probably null
R1943:Txndc12 UTSW 4 108856210 missense probably benign 0.01
R7458:Txndc12 UTSW 4 108861409 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGCCCTCAATTTTAGTTATTTAGAC -3'
(R):5'- GCTAATACGTCTCTCCCGTAAACC -3'

Sequencing Primer
(F):5'- AGACTTAACAATGGTTCCATTAGATG -3'
(R):5'- CCGTAAACCTCAGTATTATTCTCTTG -3'
Posted On2019-10-07