Incidental Mutation 'R7437:Strn3'
ID576686
Institutional Source Beutler Lab
Gene Symbol Strn3
Ensembl Gene ENSMUSG00000020954
Gene Namestriatin, calmodulin binding protein 3
SynonymsSG2NA
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7437 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51609632-51691897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51610163 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 777 (H777Q)
Ref Sequence ENSEMBL: ENSMUSP00000013130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013130] [ENSMUST00000085412] [ENSMUST00000164782] [ENSMUST00000169503]
Predicted Effect probably damaging
Transcript: ENSMUST00000013130
AA Change: H777Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013130
Gene: ENSMUSG00000020954
AA Change: H777Q

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 194 1.3e-50 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
WD40 468 507 7.05e-9 SMART
WD40 521 560 2.42e-7 SMART
WD40 574 613 1.62e-8 SMART
WD40 617 659 8.25e0 SMART
WD40 670 708 2.65e1 SMART
WD40 711 750 2.32e-9 SMART
WD40 753 796 4.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085412
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164782
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169503
AA Change: H693Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130184
Gene: ENSMUSG00000020954
AA Change: H693Q

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 198 3.2e-51 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
WD40 384 423 7.05e-9 SMART
WD40 437 476 2.42e-7 SMART
WD40 490 529 1.62e-8 SMART
WD40 533 575 8.25e0 SMART
WD40 586 624 2.65e1 SMART
WD40 627 666 2.32e-9 SMART
WD40 669 712 4.95e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Strn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Strn3 APN 12 51661196 missense possibly damaging 0.63
IGL00690:Strn3 APN 12 51610438 missense possibly damaging 0.96
IGL00886:Strn3 APN 12 51610150 missense probably damaging 1.00
IGL01967:Strn3 APN 12 51652813 missense probably damaging 1.00
IGL02507:Strn3 APN 12 51661627 nonsense probably null
IGL03139:Strn3 APN 12 51652850 splice site probably benign
IGL03282:Strn3 APN 12 51627209 missense probably benign 0.00
PIT4519001:Strn3 UTSW 12 51633708 missense probably benign 0.00
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0336:Strn3 UTSW 12 51661608 critical splice donor site probably null
R0492:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0512:Strn3 UTSW 12 51627183 missense possibly damaging 0.94
R0610:Strn3 UTSW 12 51610448 critical splice acceptor site probably null
R0707:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0834:Strn3 UTSW 12 51627096 splice site probably benign
R1562:Strn3 UTSW 12 51633618 missense probably benign
R1599:Strn3 UTSW 12 51652766 missense possibly damaging 0.78
R1663:Strn3 UTSW 12 51652826 missense probably damaging 1.00
R1807:Strn3 UTSW 12 51627203 missense probably benign 0.10
R2263:Strn3 UTSW 12 51643223 splice site probably null
R2443:Strn3 UTSW 12 51627835 missense probably damaging 1.00
R3623:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R3624:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R4154:Strn3 UTSW 12 51627131 missense probably damaging 1.00
R4223:Strn3 UTSW 12 51627855 missense probably damaging 1.00
R4400:Strn3 UTSW 12 51648100 missense possibly damaging 0.85
R4564:Strn3 UTSW 12 51633621 missense probably benign 0.00
R4585:Strn3 UTSW 12 51650170 missense probably benign 0.02
R4755:Strn3 UTSW 12 51610216 missense possibly damaging 0.70
R4794:Strn3 UTSW 12 51650171 missense probably benign 0.38
R5288:Strn3 UTSW 12 51648020 missense probably damaging 1.00
R5308:Strn3 UTSW 12 51629385 missense probably damaging 0.99
R5765:Strn3 UTSW 12 51633627 missense probably benign
R5893:Strn3 UTSW 12 51643223 splice site probably null
R5945:Strn3 UTSW 12 51629496 missense probably benign 0.00
R6244:Strn3 UTSW 12 51610107 missense probably damaging 0.98
R6523:Strn3 UTSW 12 51643098 unclassified probably null
R7545:Strn3 UTSW 12 51627760 missense probably damaging 0.98
X0024:Strn3 UTSW 12 51652709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCACCAGGCAGATCACATGTAG -3'
(R):5'- CCCAATGGAATCTATTTGATGTCTGG -3'

Sequencing Primer
(F):5'- CATGTAGTGTCATGTCAGGAACC -3'
(R):5'- TACAGGCCATGACTGTTC -3'
Posted On2019-10-07