Incidental Mutation 'R7437:C4b'
ID576694
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34734733 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 967 (D967G)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: D967G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D967G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pcdhb17 A G 18: 37,486,092 I312V probably benign Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
R7991:C4b UTSW 17 34740352 missense probably benign 0.00
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGGTTTGCTCTGCACAGC -3'
(R):5'- AGTTAGTCTACAACCTCGACCC -3'

Sequencing Primer
(F):5'- GAACCCATAGTCTCCAAGGGTTC -3'
(R):5'- TCGACCCCCTAAGTGAGTATC -3'
Posted On2019-10-07