Incidental Mutation 'R7437:C4b'
ID 576694
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 045513-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7437 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34953707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 967 (D967G)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: D967G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D967G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,619,472 (GRCm39) I1192F probably damaging Het
Abca8a A G 11: 109,941,790 (GRCm39) S1160P probably benign Het
Adamtsl2 A G 2: 26,979,721 (GRCm39) I297V probably damaging Het
Aebp1 T A 11: 5,819,757 (GRCm39) F687L possibly damaging Het
Ahsa1 A G 12: 87,314,930 (GRCm39) T28A probably damaging Het
Akap3 A T 6: 126,842,618 (GRCm39) K412N probably damaging Het
Atl1 A G 12: 69,978,396 (GRCm39) I123V probably benign Het
Atp10a G A 7: 58,308,288 (GRCm39) R29H unknown Het
Ccdc186 T C 19: 56,795,429 (GRCm39) N416S probably damaging Het
Ccna2 T C 3: 36,625,239 (GRCm39) probably benign Het
Cep70 T C 9: 99,173,582 (GRCm39) L371P probably damaging Het
Cfap46 A T 7: 139,230,753 (GRCm39) C958* probably null Het
Crlf2 T C 5: 109,702,839 (GRCm39) D318G probably benign Het
Csf1 T C 3: 107,658,072 (GRCm39) N14D probably benign Het
Dars1 A G 1: 128,299,941 (GRCm39) Y348H possibly damaging Het
Dnah2 T C 11: 69,389,453 (GRCm39) E813G probably damaging Het
Ebi3 T A 17: 56,261,410 (GRCm39) M102K probably benign Het
Epg5 A G 18: 78,066,493 (GRCm39) D2131G probably benign Het
Fam186a A T 15: 99,840,775 (GRCm39) L1823H probably damaging Het
H2-M3 T C 17: 37,583,569 (GRCm39) M309T probably benign Het
Ift122 C T 6: 115,903,263 (GRCm39) R1176C probably benign Het
Ino80 A G 2: 119,273,067 (GRCm39) S470P possibly damaging Het
Kcnh5 C T 12: 75,184,417 (GRCm39) probably null Het
Kif24 T C 4: 41,404,687 (GRCm39) T438A possibly damaging Het
Kndc1 G A 7: 139,488,959 (GRCm39) G205R probably damaging Het
Lrp1b A T 2: 40,712,657 (GRCm39) Y3226N Het
Lrp1b G T 2: 40,712,658 (GRCm39) D3225E Het
Megf10 G C 18: 57,395,203 (GRCm39) G522R probably damaging Het
Nectin2 A T 7: 19,483,193 (GRCm39) L12* probably null Het
Ngef A T 1: 87,408,327 (GRCm39) M580K probably damaging Het
Oga A T 19: 45,767,046 (GRCm39) M110K possibly damaging Het
Or10ag56 A G 2: 87,139,687 (GRCm39) M205V probably benign Het
Or1e1c A G 11: 73,265,844 (GRCm39) S93G probably benign Het
Or5an1b T C 19: 12,299,472 (GRCm39) N240D probably damaging Het
Pcdhb13 T C 18: 37,577,728 (GRCm39) L702P probably damaging Het
Pcdhb17 A G 18: 37,619,145 (GRCm39) I312V probably benign Het
Pglyrp3 A G 3: 91,937,985 (GRCm39) N265D probably benign Het
Pkd1l2 A G 8: 117,757,421 (GRCm39) V1539A probably damaging Het
Prxl2b C A 4: 154,981,053 (GRCm39) C194F possibly damaging Het
Rcn2 T C 9: 55,965,353 (GRCm39) L274P probably damaging Het
Rpp30 A G 19: 36,081,838 (GRCm39) E267G possibly damaging Het
Rundc3a A G 11: 102,289,230 (GRCm39) M134V probably damaging Het
Samd3 A T 10: 26,146,004 (GRCm39) Q343L possibly damaging Het
Serpinb3c A T 1: 107,199,444 (GRCm39) F359Y probably damaging Het
Slc9a9 T C 9: 95,110,994 (GRCm39) L604P probably benign Het
Strn3 A T 12: 51,656,946 (GRCm39) H777Q probably damaging Het
Tap1 G A 17: 34,409,616 (GRCm39) W284* probably null Het
Tlcd5 C T 9: 43,023,080 (GRCm39) W91* probably null Het
Tmem181a A G 17: 6,353,540 (GRCm39) D384G possibly damaging Het
Txndc12 T C 4: 108,713,368 (GRCm39) S77P probably damaging Het
Wnt16 G A 6: 22,288,560 (GRCm39) V19M probably benign Het
Zfp932 T A 5: 110,157,880 (GRCm39) M526K probably benign Het
Zfp959 G T 17: 56,205,334 (GRCm39) C457F probably damaging Het
Zscan4-ps3 T C 7: 11,346,863 (GRCm39) S300P probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGGTTTGCTCTGCACAGC -3'
(R):5'- AGTTAGTCTACAACCTCGACCC -3'

Sequencing Primer
(F):5'- GAACCCATAGTCTCCAAGGGTTC -3'
(R):5'- TCGACCCCCTAAGTGAGTATC -3'
Posted On 2019-10-07