Incidental Mutation 'R7437:Pcdhb17'
ID576699
Institutional Source Beutler Lab
Gene Symbol Pcdhb17
Ensembl Gene ENSMUSG00000046387
Gene Nameprotocadherin beta 17
SynonymsPcdhbQ, Pcdhb16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7437 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37484795-37489454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37486092 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 312 (I312V)
Ref Sequence ENSEMBL: ENSMUSP00000055072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053856
AA Change: I312V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387
AA Change: I312V

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,400,498 I1192F probably damaging Het
Abca8a A G 11: 110,050,964 S1160P probably benign Het
Adamtsl2 A G 2: 27,089,709 I297V probably damaging Het
Aebp1 T A 11: 5,869,757 F687L possibly damaging Het
Ahsa1 A G 12: 87,268,156 T28A probably damaging Het
Akap3 A T 6: 126,865,655 K412N probably damaging Het
Atl1 A G 12: 69,931,622 I123V probably benign Het
Atp10a G A 7: 58,658,540 R29H unknown Het
C4b T C 17: 34,734,733 D967G probably benign Het
Ccdc186 T C 19: 56,806,997 N416S probably damaging Het
Ccna2 T C 3: 36,571,090 probably benign Het
Cep70 T C 9: 99,291,529 L371P probably damaging Het
Cfap46 A T 7: 139,650,837 C958* probably null Het
Crlf2 T C 5: 109,554,973 D318G probably benign Het
Csf1 T C 3: 107,750,756 N14D probably benign Het
Dars A G 1: 128,372,204 Y348H possibly damaging Het
Dnah2 T C 11: 69,498,627 E813G probably damaging Het
Ebi3 T A 17: 55,954,410 M102K probably benign Het
Epg5 A G 18: 78,023,278 D2131G probably benign Het
Fam186a A T 15: 99,942,894 L1823H probably damaging Het
Fam213b C A 4: 154,896,596 C194F possibly damaging Het
H2-M3 T C 17: 37,272,678 M309T probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ino80 A G 2: 119,442,586 S470P possibly damaging Het
Kcnh5 C T 12: 75,137,643 probably null Het
Kif24 T C 4: 41,404,687 T438A possibly damaging Het
Kndc1 G A 7: 139,909,043 G205R probably damaging Het
Lrp1b A T 2: 40,822,645 Y3226N Het
Lrp1b G T 2: 40,822,646 D3225E Het
Megf10 G C 18: 57,262,131 G522R probably damaging Het
Mgea5 A T 19: 45,778,607 M110K possibly damaging Het
Nectin2 A T 7: 19,749,268 L12* probably null Het
Ngef A T 1: 87,480,605 M580K probably damaging Het
Olfr1118 A G 2: 87,309,343 M205V probably benign Het
Olfr1437 T C 19: 12,322,108 N240D probably damaging Het
Olfr376 A G 11: 73,375,018 S93G probably benign Het
Pcdhb13 T C 18: 37,444,675 L702P probably damaging Het
Pglyrp3 A G 3: 92,030,678 N265D probably benign Het
Pkd1l2 A G 8: 117,030,682 V1539A probably damaging Het
Rcn2 T C 9: 56,058,069 L274P probably damaging Het
Rpp30 A G 19: 36,104,438 E267G possibly damaging Het
Rundc3a A G 11: 102,398,404 M134V probably damaging Het
Samd3 A T 10: 26,270,106 Q343L possibly damaging Het
Serpinb3c A T 1: 107,271,714 F359Y probably damaging Het
Slc9a9 T C 9: 95,228,941 L604P probably benign Het
Strn3 A T 12: 51,610,163 H777Q probably damaging Het
Tap1 G A 17: 34,190,642 W284* probably null Het
Tmem136 C T 9: 43,111,785 W91* probably null Het
Tmem181a A G 17: 6,303,265 D384G possibly damaging Het
Txndc12 T C 4: 108,856,171 S77P probably damaging Het
Wnt16 G A 6: 22,288,561 V19M probably benign Het
Zfp932 T A 5: 110,010,014 M526K probably benign Het
Zfp959 G T 17: 55,898,334 C457F probably damaging Het
Zscan4-ps3 T C 7: 11,612,936 S300P probably benign Het
Other mutations in Pcdhb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Pcdhb17 APN 18 37486006 unclassified probably null
IGL01367:Pcdhb17 APN 18 37487495 missense probably benign 0.01
IGL01923:Pcdhb17 APN 18 37486737 missense probably benign 0.43
IGL02060:Pcdhb17 APN 18 37486416 missense probably damaging 1.00
IGL02494:Pcdhb17 APN 18 37485294 missense possibly damaging 0.73
IGL02654:Pcdhb17 APN 18 37486561 missense probably benign 0.03
IGL03168:Pcdhb17 APN 18 37485772 missense probably benign 0.15
doughnut UTSW 18 37486936 missense probably damaging 1.00
miniscule UTSW 18 37485667 missense probably damaging 1.00
PIT4434001:Pcdhb17 UTSW 18 37485651 missense probably damaging 1.00
R0364:Pcdhb17 UTSW 18 37485835 missense possibly damaging 0.95
R1013:Pcdhb17 UTSW 18 37485967 missense probably damaging 1.00
R1052:Pcdhb17 UTSW 18 37486846 missense probably damaging 1.00
R1226:Pcdhb17 UTSW 18 37487260 missense probably damaging 1.00
R1258:Pcdhb17 UTSW 18 37485534 missense probably damaging 0.98
R1335:Pcdhb17 UTSW 18 37486234 missense probably damaging 1.00
R1443:Pcdhb17 UTSW 18 37486648 missense probably benign 0.15
R1451:Pcdhb17 UTSW 18 37486936 missense probably damaging 1.00
R1505:Pcdhb17 UTSW 18 37486822 missense probably damaging 1.00
R1591:Pcdhb17 UTSW 18 37485825 missense probably damaging 1.00
R1742:Pcdhb17 UTSW 18 37486576 missense probably damaging 0.99
R1750:Pcdhb17 UTSW 18 37485711 missense probably damaging 1.00
R1750:Pcdhb17 UTSW 18 37487017 missense possibly damaging 0.81
R1764:Pcdhb17 UTSW 18 37487271 missense probably damaging 1.00
R1863:Pcdhb17 UTSW 18 37486111 missense probably benign 0.00
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R2095:Pcdhb17 UTSW 18 37486322 missense probably benign 0.14
R4565:Pcdhb17 UTSW 18 37486470 missense probably benign 0.14
R4658:Pcdhb17 UTSW 18 37486599 missense probably damaging 1.00
R4669:Pcdhb17 UTSW 18 37486206 missense probably damaging 0.99
R4816:Pcdhb17 UTSW 18 37487397 missense probably benign 0.39
R4910:Pcdhb17 UTSW 18 37485159 start codon destroyed possibly damaging 0.90
R5209:Pcdhb17 UTSW 18 37487461 missense probably damaging 1.00
R5248:Pcdhb17 UTSW 18 37485886 missense probably benign 0.00
R5254:Pcdhb17 UTSW 18 37486825 missense probably damaging 1.00
R5494:Pcdhb17 UTSW 18 37487247 missense probably damaging 1.00
R5544:Pcdhb17 UTSW 18 37487421 missense possibly damaging 0.61
R5952:Pcdhb17 UTSW 18 37487080 missense probably benign 0.04
R5977:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6262:Pcdhb17 UTSW 18 37486698 missense probably damaging 1.00
R6311:Pcdhb17 UTSW 18 37486263 unclassified probably null
R6495:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6710:Pcdhb17 UTSW 18 37485399 missense probably damaging 0.96
R7097:Pcdhb17 UTSW 18 37486513 missense probably benign
R7122:Pcdhb17 UTSW 18 37486513 missense probably benign
R7130:Pcdhb17 UTSW 18 37485445 missense probably damaging 1.00
R7642:Pcdhb17 UTSW 18 37485726 missense probably damaging 1.00
R7703:Pcdhb17 UTSW 18 37486748 missense probably benign 0.01
R7771:Pcdhb17 UTSW 18 37486909 missense possibly damaging 0.95
R7898:Pcdhb17 UTSW 18 37485180 missense probably benign 0.00
R7981:Pcdhb17 UTSW 18 37485180 missense probably benign 0.00
X0062:Pcdhb17 UTSW 18 37486489 missense probably benign
X0064:Pcdhb17 UTSW 18 37486431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGAGTGCAAATTCCCGAG -3'
(R):5'- TTTCCATTGTTCGCTGAATCAGG -3'

Sequencing Primer
(F):5'- GAGTGCAAATTCCCGAGAACAGTC -3'
(R):5'- CGCTGAATCAGGATCTTTAACACTG -3'
Posted On2019-10-07