Mutagenetix > Incidental Mutation

Incidental Mutation 'R7438:Skint6'

576717

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R7438 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113238228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 78 (N78I)

Ref Sequence

ENSEMBL: ENSMUSP00000121870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000138966
AA Change: N78I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: N78I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171224
AA Change: N78I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: N78I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (88/88)

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	T	C	14: 118,616,446	S425G	probably benign	Het
Adam29	A	G	8: 55,871,574	I615T	probably damaging	Het
Arap2	A	T	5: 62,749,475	I67N	probably damaging	Het
Asxl2	C	T	12: 3,427,108		probably benign	Het
Atp13a4	C	T	16: 29,441,196	G607D		Het
Atp2c2	G	A	8: 119,748,197	V514M	probably damaging	Het
Baiap3	A	G	17: 25,249,108	C311R	possibly damaging	Het
Becn1	A	C	11: 101,294,226	S137R	probably benign	Het
C1qtnf6	G	T	15: 78,525,374	T91K	probably benign	Het
C8a	T	C	4: 104,861,429	K110E	probably damaging	Het
Camta2	A	G	11: 70,683,888		probably null	Het
Capn8	T	A	1: 182,598,675	Y192N	probably damaging	Het
Ccdc170	C	T	10: 4,558,512	Q579*	probably null	Het
Cenpa	G	T	5: 30,666,948		probably benign	Het
Cltc	A	G	11: 86,725,228	V404A	probably benign	Het
Cyp3a11	A	T	5: 145,865,900	L261Q	probably benign	Het
Daw1	T	A	1: 83,192,715	S249R	probably benign	Het
Dchs1	T	A	7: 105,754,948	I2796F	probably benign	Het
Dis3l2	T	C	1: 86,745,500		probably null	Het
Dnah5	A	T	15: 28,346,952	D2527V	probably damaging	Het
Dsg4	G	A	18: 20,466,628	R767Q	probably damaging	Het
Edaradd	A	G	13: 12,478,457	I118T	probably damaging	Het
Fam60a	A	G	6: 148,933,102	Y10H	probably benign	Het
Fam83h	A	G	15: 76,004,426	F354S	possibly damaging	Het
Fat3	A	G	9: 15,988,482	V3085A	probably benign	Het
Fer	A	G	17: 64,133,521	D711G	possibly damaging	Het
G6pc	G	T	11: 101,376,677	V318F	probably benign	Het
Gal3st1	C	A	11: 3,998,227	H145N	probably benign	Het
Gm13088	T	C	4: 143,655,560	I189V	probably damaging	Het
Helz	C	T	11: 107,662,030	P1211S	probably damaging	Het
Herc1	A	G	9: 66,394,756	I667V	probably benign	Het
Herc2	T	A	7: 56,103,718		probably null	Het
Hivep1	C	T	13: 42,154,911	T209I	probably damaging	Het
Hsph1	A	G	5: 149,619,020	Y678H	probably damaging	Het
Ift122	C	T	6: 115,926,302	R1176C	probably benign	Het
Ighv1-23	T	C	12: 114,764,475	D109G	probably damaging	Het
Itgb3	T	C	11: 104,643,577	V420A	possibly damaging	Het
Kcnk13	C	A	12: 100,061,726	N353K	probably damaging	Het
Kif21a	A	G	15: 90,993,796	F270L	probably benign	Het
Kit	T	A	5: 75,639,000	V464D	probably benign	Het
Klhl36	G	A	8: 119,870,175	W205*	probably null	Het
Krt17	A	G	11: 100,258,465	Y260H	probably damaging	Het
Lats1	C	T	10: 7,712,942	Q1108*	probably null	Het
Lrch1	G	A	14: 74,757,037	T709I	possibly damaging	Het
Lrrc58	C	A	16: 37,868,691	Q66K	probably benign	Het
Mei1	G	A	15: 82,115,481	A664T		Het
Mtmr6	C	T	14: 60,300,304	T546M	probably benign	Het
Ncoa3	T	A	2: 166,068,529	F1288L	probably damaging	Het
Nwd1	G	T	8: 72,707,830	V1352L	probably benign	Het
Olfr1283	T	A	2: 111,369,362	H243Q	probably damaging	Het
Olfr199	A	T	16: 59,216,398	C72S	probably benign	Het
Ovol3	C	T	7: 30,235,221		probably null	Het
Palb2	C	A	7: 122,117,331	V843L	probably damaging	Het
Pds5a	T	A	5: 65,652,535		probably null	Het
Per1	A	G	11: 69,104,735	S714G	possibly damaging	Het
Plch2	G	A	4: 155,000,460	R442C	probably damaging	Het
Pon2	A	T	6: 5,289,080	S26R	probably benign	Het
Ppp1r9a	A	T	6: 5,115,378	N834Y	probably damaging	Het
Rbm46	C	T	3: 82,842,488	W483*	probably null	Het
Rnd1	A	T	15: 98,673,901	V88E	probably damaging	Het
Sbno2	T	A	10: 80,069,575	T142S	unknown	Het
Scn9a	C	T	2: 66,547,187	V384M	possibly damaging	Het
Sertad4	T	A	1: 192,846,710	H266L	possibly damaging	Het
Setd5	T	A	6: 113,115,082	M288K	possibly damaging	Het
Sfxn4	T	A	19: 60,857,361	N66Y	probably damaging	Het
Sltm	G	T	9: 70,573,466	G200V	unknown	Het
Smg1	A	G	7: 118,195,893	I477T	unknown	Het
Supv3l1	C	T	10: 62,430,470		probably null	Het
Syne2	A	G	12: 76,015,563	R4220G	probably benign	Het
Tbr1	A	T	2: 61,804,817	H37L	possibly damaging	Het
Tet3	TGGCCCAGGCCCAGGC	TGGCCCAGGCCCAGGCCCAGGC	6: 83,368,229		probably benign	Het
Tmem231	G	T	8: 111,918,408	S155R	probably damaging	Het
Trem3	A	G	17: 48,258,470	*184W	probably null	Het
Trim33	T	A	3: 103,346,640		probably benign	Het
Tsen2	G	A	6: 115,559,982	W233*	probably null	Het
Ttc21a	T	A	9: 119,945,539	N286K	probably damaging	Het
Tulp4	A	T	17: 6,198,708	M194L	probably benign	Het
Ube3b	C	A	5: 114,415,284	R906S	possibly damaging	Het
Ube3b	A	C	5: 114,418,626	D1006A	probably damaging	Het
Vipas39	A	T	12: 87,241,931		probably null	Het
Wdr35	T	A	12: 9,022,785	Y920N	probably damaging	Het
Zan	T	G	5: 137,425,562	I2692L	unknown	Het
Zfp142	C	A	1: 74,585,520	E48D	probably benign	Het
Zfp598	T	C	17: 24,677,530	Y194H	probably damaging	Het
Zfp85	T	C	13: 67,748,945	N336S	probably benign	Het
Zfyve27	A	T	19: 42,189,520		probably null	Het
Zp3	T	C	5: 135,982,705	S126P	probably damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7536:Skint6	UTSW	4	112811547	critical splice acceptor site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACATAGGTACACAGCAGTAGC -3'
(R):5'- GATTGTTGTAATCCTCCACAGAAC -3'

Sequencing Primer
(F):5'- GGATCCATGCCTACCTGTGAC -3'
(R):5'- CAGAACAATTCACTGTGAATGGC -3'

Posted On

2019-10-07