Incidental Mutation 'R7438:Skint6'
ID 576717
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 045514-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7438 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113095425 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 78 (N78I)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000138966
AA Change: N78I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: N78I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171224
AA Change: N78I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: N78I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,853,858 (GRCm39) S425G probably benign Het
Adam29 A G 8: 56,324,609 (GRCm39) I615T probably damaging Het
Arap2 A T 5: 62,906,818 (GRCm39) I67N probably damaging Het
Asxl2 C T 12: 3,477,108 (GRCm39) probably benign Het
Atp13a4 C T 16: 29,260,014 (GRCm39) G607D Het
Atp2c2 G A 8: 120,474,936 (GRCm39) V514M probably damaging Het
Baiap3 A G 17: 25,468,082 (GRCm39) C311R possibly damaging Het
Becn1 A C 11: 101,185,052 (GRCm39) S137R probably benign Het
C1qtnf6 G T 15: 78,409,574 (GRCm39) T91K probably benign Het
C8a T C 4: 104,718,626 (GRCm39) K110E probably damaging Het
Camta2 A G 11: 70,574,714 (GRCm39) probably null Het
Capn8 T A 1: 182,426,240 (GRCm39) Y192N probably damaging Het
Ccdc170 C T 10: 4,508,512 (GRCm39) Q579* probably null Het
Cenpa G T 5: 30,824,292 (GRCm39) probably benign Het
Cltc A G 11: 86,616,054 (GRCm39) V404A probably benign Het
Cyp3a11 A T 5: 145,802,710 (GRCm39) L261Q probably benign Het
Daw1 T A 1: 83,170,436 (GRCm39) S249R probably benign Het
Dchs1 T A 7: 105,404,155 (GRCm39) I2796F probably benign Het
Dis3l2 T C 1: 86,673,222 (GRCm39) probably null Het
Dnah5 A T 15: 28,347,098 (GRCm39) D2527V probably damaging Het
Dsg4 G A 18: 20,599,685 (GRCm39) R767Q probably damaging Het
Edaradd A G 13: 12,493,338 (GRCm39) I118T probably damaging Het
Fam83h A G 15: 75,876,275 (GRCm39) F354S possibly damaging Het
Fat3 A G 9: 15,899,778 (GRCm39) V3085A probably benign Het
Fer A G 17: 64,440,516 (GRCm39) D711G possibly damaging Het
G6pc1 G T 11: 101,267,503 (GRCm39) V318F probably benign Het
Gal3st1 C A 11: 3,948,227 (GRCm39) H145N probably benign Het
Helz C T 11: 107,552,856 (GRCm39) P1211S probably damaging Het
Herc1 A G 9: 66,302,038 (GRCm39) I667V probably benign Het
Herc2 T A 7: 55,753,466 (GRCm39) probably null Het
Hivep1 C T 13: 42,308,387 (GRCm39) T209I probably damaging Het
Hsph1 A G 5: 149,542,485 (GRCm39) Y678H probably damaging Het
Ift122 C T 6: 115,903,263 (GRCm39) R1176C probably benign Het
Ighv1-23 T C 12: 114,728,095 (GRCm39) D109G probably damaging Het
Itgb3 T C 11: 104,534,403 (GRCm39) V420A possibly damaging Het
Kcnk13 C A 12: 100,027,985 (GRCm39) N353K probably damaging Het
Kif21a A G 15: 90,877,999 (GRCm39) F270L probably benign Het
Kit T A 5: 75,799,660 (GRCm39) V464D probably benign Het
Klhl36 G A 8: 120,596,914 (GRCm39) W205* probably null Het
Krt17 A G 11: 100,149,291 (GRCm39) Y260H probably damaging Het
Lats1 C T 10: 7,588,706 (GRCm39) Q1108* probably null Het
Lrch1 G A 14: 74,994,477 (GRCm39) T709I possibly damaging Het
Lrrc58 C A 16: 37,689,053 (GRCm39) Q66K probably benign Het
Mei1 G A 15: 81,999,682 (GRCm39) A664T Het
Mtmr6 C T 14: 60,537,753 (GRCm39) T546M probably benign Het
Ncoa3 T A 2: 165,910,449 (GRCm39) F1288L probably damaging Het
Nwd1 G T 8: 73,434,458 (GRCm39) V1352L probably benign Het
Or4k77 T A 2: 111,199,707 (GRCm39) H243Q probably damaging Het
Or5ac17 A T 16: 59,036,761 (GRCm39) C72S probably benign Het
Ovol3 C T 7: 29,934,646 (GRCm39) probably null Het
Palb2 C A 7: 121,716,554 (GRCm39) V843L probably damaging Het
Pds5a T A 5: 65,809,878 (GRCm39) probably null Het
Per1 A G 11: 68,995,561 (GRCm39) S714G possibly damaging Het
Plch2 G A 4: 155,084,917 (GRCm39) R442C probably damaging Het
Pon2 A T 6: 5,289,080 (GRCm39) S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 (GRCm39) N834Y probably damaging Het
Pramel22 T C 4: 143,382,130 (GRCm39) I189V probably damaging Het
Rbm46 C T 3: 82,749,795 (GRCm39) W483* probably null Het
Rnd1 A T 15: 98,571,782 (GRCm39) V88E probably damaging Het
Sbno2 T A 10: 79,905,409 (GRCm39) T142S unknown Het
Scn9a C T 2: 66,377,531 (GRCm39) V384M possibly damaging Het
Sertad4 T A 1: 192,529,018 (GRCm39) H266L possibly damaging Het
Setd5 T A 6: 113,092,043 (GRCm39) M288K possibly damaging Het
Sfxn4 T A 19: 60,845,799 (GRCm39) N66Y probably damaging Het
Sinhcaf A G 6: 148,834,600 (GRCm39) Y10H probably benign Het
Sltm G T 9: 70,480,748 (GRCm39) G200V unknown Het
Smg1 A G 7: 117,795,116 (GRCm39) I477T unknown Het
Supv3l1 C T 10: 62,266,249 (GRCm39) probably null Het
Syne2 A G 12: 76,062,337 (GRCm39) R4220G probably benign Het
Tbr1 A T 2: 61,635,161 (GRCm39) H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,345,211 (GRCm39) probably benign Het
Tmem231 G T 8: 112,645,040 (GRCm39) S155R probably damaging Het
Trem3 A G 17: 48,565,498 (GRCm39) *184W probably null Het
Trim33 T A 3: 103,253,956 (GRCm39) probably benign Het
Tsen2 G A 6: 115,536,943 (GRCm39) W233* probably null Het
Ttc21a T A 9: 119,774,605 (GRCm39) N286K probably damaging Het
Tulp4 A T 17: 6,248,983 (GRCm39) M194L probably benign Het
Ube3b C A 5: 114,553,345 (GRCm39) R906S possibly damaging Het
Ube3b A C 5: 114,556,687 (GRCm39) D1006A probably damaging Het
Vipas39 A T 12: 87,288,705 (GRCm39) probably null Het
Wdr35 T A 12: 9,072,785 (GRCm39) Y920N probably damaging Het
Zan T G 5: 137,423,824 (GRCm39) I2692L unknown Het
Zfp142 C A 1: 74,624,679 (GRCm39) E48D probably benign Het
Zfp598 T C 17: 24,896,504 (GRCm39) Y194H probably damaging Het
Zfp85 T C 13: 67,897,064 (GRCm39) N336S probably benign Het
Zfyve27 A T 19: 42,177,959 (GRCm39) probably null Het
Zp3 T C 5: 136,011,559 (GRCm39) S126P probably damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATAGGTACACAGCAGTAGC -3'
(R):5'- GATTGTTGTAATCCTCCACAGAAC -3'

Sequencing Primer
(F):5'- GGATCCATGCCTACCTGTGAC -3'
(R):5'- CAGAACAATTCACTGTGAATGGC -3'
Posted On 2019-10-07