Incidental Mutation 'R7438:Ube3b'
ID 576724
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
MMRRC Submission 045514-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7438 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 114553345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 906 (R906S)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect possibly damaging
Transcript: ENSMUST00000074002
AA Change: R906S

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: R906S

IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,853,858 (GRCm39) S425G probably benign Het
Adam29 A G 8: 56,324,609 (GRCm39) I615T probably damaging Het
Arap2 A T 5: 62,906,818 (GRCm39) I67N probably damaging Het
Asxl2 C T 12: 3,477,108 (GRCm39) probably benign Het
Atp13a4 C T 16: 29,260,014 (GRCm39) G607D Het
Atp2c2 G A 8: 120,474,936 (GRCm39) V514M probably damaging Het
Baiap3 A G 17: 25,468,082 (GRCm39) C311R possibly damaging Het
Becn1 A C 11: 101,185,052 (GRCm39) S137R probably benign Het
C1qtnf6 G T 15: 78,409,574 (GRCm39) T91K probably benign Het
C8a T C 4: 104,718,626 (GRCm39) K110E probably damaging Het
Camta2 A G 11: 70,574,714 (GRCm39) probably null Het
Capn8 T A 1: 182,426,240 (GRCm39) Y192N probably damaging Het
Ccdc170 C T 10: 4,508,512 (GRCm39) Q579* probably null Het
Cenpa G T 5: 30,824,292 (GRCm39) probably benign Het
Cltc A G 11: 86,616,054 (GRCm39) V404A probably benign Het
Cyp3a11 A T 5: 145,802,710 (GRCm39) L261Q probably benign Het
Daw1 T A 1: 83,170,436 (GRCm39) S249R probably benign Het
Dchs1 T A 7: 105,404,155 (GRCm39) I2796F probably benign Het
Dis3l2 T C 1: 86,673,222 (GRCm39) probably null Het
Dnah5 A T 15: 28,347,098 (GRCm39) D2527V probably damaging Het
Dsg4 G A 18: 20,599,685 (GRCm39) R767Q probably damaging Het
Edaradd A G 13: 12,493,338 (GRCm39) I118T probably damaging Het
Fam83h A G 15: 75,876,275 (GRCm39) F354S possibly damaging Het
Fat3 A G 9: 15,899,778 (GRCm39) V3085A probably benign Het
Fer A G 17: 64,440,516 (GRCm39) D711G possibly damaging Het
G6pc1 G T 11: 101,267,503 (GRCm39) V318F probably benign Het
Gal3st1 C A 11: 3,948,227 (GRCm39) H145N probably benign Het
Helz C T 11: 107,552,856 (GRCm39) P1211S probably damaging Het
Herc1 A G 9: 66,302,038 (GRCm39) I667V probably benign Het
Herc2 T A 7: 55,753,466 (GRCm39) probably null Het
Hivep1 C T 13: 42,308,387 (GRCm39) T209I probably damaging Het
Hsph1 A G 5: 149,542,485 (GRCm39) Y678H probably damaging Het
Ift122 C T 6: 115,903,263 (GRCm39) R1176C probably benign Het
Ighv1-23 T C 12: 114,728,095 (GRCm39) D109G probably damaging Het
Itgb3 T C 11: 104,534,403 (GRCm39) V420A possibly damaging Het
Kcnk13 C A 12: 100,027,985 (GRCm39) N353K probably damaging Het
Kif21a A G 15: 90,877,999 (GRCm39) F270L probably benign Het
Kit T A 5: 75,799,660 (GRCm39) V464D probably benign Het
Klhl36 G A 8: 120,596,914 (GRCm39) W205* probably null Het
Krt17 A G 11: 100,149,291 (GRCm39) Y260H probably damaging Het
Lats1 C T 10: 7,588,706 (GRCm39) Q1108* probably null Het
Lrch1 G A 14: 74,994,477 (GRCm39) T709I possibly damaging Het
Lrrc58 C A 16: 37,689,053 (GRCm39) Q66K probably benign Het
Mei1 G A 15: 81,999,682 (GRCm39) A664T Het
Mtmr6 C T 14: 60,537,753 (GRCm39) T546M probably benign Het
Ncoa3 T A 2: 165,910,449 (GRCm39) F1288L probably damaging Het
Nwd1 G T 8: 73,434,458 (GRCm39) V1352L probably benign Het
Or4k77 T A 2: 111,199,707 (GRCm39) H243Q probably damaging Het
Or5ac17 A T 16: 59,036,761 (GRCm39) C72S probably benign Het
Ovol3 C T 7: 29,934,646 (GRCm39) probably null Het
Palb2 C A 7: 121,716,554 (GRCm39) V843L probably damaging Het
Pds5a T A 5: 65,809,878 (GRCm39) probably null Het
Per1 A G 11: 68,995,561 (GRCm39) S714G possibly damaging Het
Plch2 G A 4: 155,084,917 (GRCm39) R442C probably damaging Het
Pon2 A T 6: 5,289,080 (GRCm39) S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 (GRCm39) N834Y probably damaging Het
Pramel22 T C 4: 143,382,130 (GRCm39) I189V probably damaging Het
Rbm46 C T 3: 82,749,795 (GRCm39) W483* probably null Het
Rnd1 A T 15: 98,571,782 (GRCm39) V88E probably damaging Het
Sbno2 T A 10: 79,905,409 (GRCm39) T142S unknown Het
Scn9a C T 2: 66,377,531 (GRCm39) V384M possibly damaging Het
Sertad4 T A 1: 192,529,018 (GRCm39) H266L possibly damaging Het
Setd5 T A 6: 113,092,043 (GRCm39) M288K possibly damaging Het
Sfxn4 T A 19: 60,845,799 (GRCm39) N66Y probably damaging Het
Sinhcaf A G 6: 148,834,600 (GRCm39) Y10H probably benign Het
Skint6 T A 4: 113,095,425 (GRCm39) N78I probably damaging Het
Sltm G T 9: 70,480,748 (GRCm39) G200V unknown Het
Smg1 A G 7: 117,795,116 (GRCm39) I477T unknown Het
Supv3l1 C T 10: 62,266,249 (GRCm39) probably null Het
Syne2 A G 12: 76,062,337 (GRCm39) R4220G probably benign Het
Tbr1 A T 2: 61,635,161 (GRCm39) H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,345,211 (GRCm39) probably benign Het
Tmem231 G T 8: 112,645,040 (GRCm39) S155R probably damaging Het
Trem3 A G 17: 48,565,498 (GRCm39) *184W probably null Het
Trim33 T A 3: 103,253,956 (GRCm39) probably benign Het
Tsen2 G A 6: 115,536,943 (GRCm39) W233* probably null Het
Ttc21a T A 9: 119,774,605 (GRCm39) N286K probably damaging Het
Tulp4 A T 17: 6,248,983 (GRCm39) M194L probably benign Het
Vipas39 A T 12: 87,288,705 (GRCm39) probably null Het
Wdr35 T A 12: 9,072,785 (GRCm39) Y920N probably damaging Het
Zan T G 5: 137,423,824 (GRCm39) I2692L unknown Het
Zfp142 C A 1: 74,624,679 (GRCm39) E48D probably benign Het
Zfp598 T C 17: 24,896,504 (GRCm39) Y194H probably damaging Het
Zfp85 T C 13: 67,897,064 (GRCm39) N336S probably benign Het
Zfyve27 A T 19: 42,177,959 (GRCm39) probably null Het
Zp3 T C 5: 136,011,559 (GRCm39) S126P probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-10-07