Incidental Mutation 'R7438:Fam60a'
ID576736
Institutional Source Beutler Lab
Gene Symbol Fam60a
Ensembl Gene ENSMUSG00000039985
Gene Namefamily with sequence similarity 60, member A
SynonymsPptcs1, Tera
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7438 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location148921035-148946467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148933102 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 10 (Y10H)
Ref Sequence ENSEMBL: ENSMUSP00000050952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054080] [ENSMUST00000081956] [ENSMUST00000111562] [ENSMUST00000132696] [ENSMUST00000139355] [ENSMUST00000146457] [ENSMUST00000203164] [ENSMUST00000204119] [ENSMUST00000204435] [ENSMUST00000204590]
Predicted Effect probably benign
Transcript: ENSMUST00000054080
AA Change: Y10H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050952
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 198 5.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081956
AA Change: Y10H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107188
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 200 5.5e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111562
AA Change: Y10H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107187
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 200 5.5e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132696
AA Change: Y10H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115417
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 156 2.8e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139355
AA Change: Y10H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119540
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 95 6.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146457
AA Change: Y10H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117859
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 53 1.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203164
AA Change: Y10H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000145370
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 133 8.1e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204119
AA Change: Y10H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000204435
AA Change: Y10H

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145487
Gene: ENSMUSG00000039985
AA Change: Y10H

DomainStartEndE-ValueType
Pfam:FAM60A 2 198 5.2e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204590
AA Change: Y10H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,616,446 S425G probably benign Het
Adam29 A G 8: 55,871,574 I615T probably damaging Het
Arap2 A T 5: 62,749,475 I67N probably damaging Het
Asxl2 C T 12: 3,427,108 probably benign Het
Atp13a4 C T 16: 29,441,196 G607D Het
Atp2c2 G A 8: 119,748,197 V514M probably damaging Het
Baiap3 A G 17: 25,249,108 C311R possibly damaging Het
Becn1 A C 11: 101,294,226 S137R probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
C8a T C 4: 104,861,429 K110E probably damaging Het
Camta2 A G 11: 70,683,888 probably null Het
Capn8 T A 1: 182,598,675 Y192N probably damaging Het
Ccdc170 C T 10: 4,558,512 Q579* probably null Het
Cenpa G T 5: 30,666,948 probably benign Het
Cltc A G 11: 86,725,228 V404A probably benign Het
Cyp3a11 A T 5: 145,865,900 L261Q probably benign Het
Daw1 T A 1: 83,192,715 S249R probably benign Het
Dchs1 T A 7: 105,754,948 I2796F probably benign Het
Dis3l2 T C 1: 86,745,500 probably null Het
Dnah5 A T 15: 28,346,952 D2527V probably damaging Het
Dsg4 G A 18: 20,466,628 R767Q probably damaging Het
Edaradd A G 13: 12,478,457 I118T probably damaging Het
Fam83h A G 15: 76,004,426 F354S possibly damaging Het
Fat3 A G 9: 15,988,482 V3085A probably benign Het
Fer A G 17: 64,133,521 D711G possibly damaging Het
G6pc G T 11: 101,376,677 V318F probably benign Het
Gal3st1 C A 11: 3,998,227 H145N probably benign Het
Gm13088 T C 4: 143,655,560 I189V probably damaging Het
Helz C T 11: 107,662,030 P1211S probably damaging Het
Herc1 A G 9: 66,394,756 I667V probably benign Het
Herc2 T A 7: 56,103,718 probably null Het
Hivep1 C T 13: 42,154,911 T209I probably damaging Het
Hsph1 A G 5: 149,619,020 Y678H probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ighv1-23 T C 12: 114,764,475 D109G probably damaging Het
Itgb3 T C 11: 104,643,577 V420A possibly damaging Het
Kcnk13 C A 12: 100,061,726 N353K probably damaging Het
Kif21a A G 15: 90,993,796 F270L probably benign Het
Kit T A 5: 75,639,000 V464D probably benign Het
Klhl36 G A 8: 119,870,175 W205* probably null Het
Krt17 A G 11: 100,258,465 Y260H probably damaging Het
Lats1 C T 10: 7,712,942 Q1108* probably null Het
Lrch1 G A 14: 74,757,037 T709I possibly damaging Het
Lrrc58 C A 16: 37,868,691 Q66K probably benign Het
Mei1 G A 15: 82,115,481 A664T Het
Mtmr6 C T 14: 60,300,304 T546M probably benign Het
Ncoa3 T A 2: 166,068,529 F1288L probably damaging Het
Nwd1 G T 8: 72,707,830 V1352L probably benign Het
Olfr1283 T A 2: 111,369,362 H243Q probably damaging Het
Olfr199 A T 16: 59,216,398 C72S probably benign Het
Ovol3 C T 7: 30,235,221 probably null Het
Palb2 C A 7: 122,117,331 V843L probably damaging Het
Pds5a T A 5: 65,652,535 probably null Het
Per1 A G 11: 69,104,735 S714G possibly damaging Het
Plch2 G A 4: 155,000,460 R442C probably damaging Het
Pon2 A T 6: 5,289,080 S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 N834Y probably damaging Het
Rbm46 C T 3: 82,842,488 W483* probably null Het
Rnd1 A T 15: 98,673,901 V88E probably damaging Het
Sbno2 T A 10: 80,069,575 T142S unknown Het
Scn9a C T 2: 66,547,187 V384M possibly damaging Het
Sertad4 T A 1: 192,846,710 H266L possibly damaging Het
Setd5 T A 6: 113,115,082 M288K possibly damaging Het
Sfxn4 T A 19: 60,857,361 N66Y probably damaging Het
Skint6 T A 4: 113,238,228 N78I probably damaging Het
Sltm G T 9: 70,573,466 G200V unknown Het
Smg1 A G 7: 118,195,893 I477T unknown Het
Supv3l1 C T 10: 62,430,470 probably null Het
Syne2 A G 12: 76,015,563 R4220G probably benign Het
Tbr1 A T 2: 61,804,817 H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Tmem231 G T 8: 111,918,408 S155R probably damaging Het
Trem3 A G 17: 48,258,470 *184W probably null Het
Trim33 T A 3: 103,346,640 probably benign Het
Tsen2 G A 6: 115,559,982 W233* probably null Het
Ttc21a T A 9: 119,945,539 N286K probably damaging Het
Tulp4 A T 17: 6,198,708 M194L probably benign Het
Ube3b A C 5: 114,418,626 D1006A probably damaging Het
Ube3b C A 5: 114,415,284 R906S possibly damaging Het
Vipas39 A T 12: 87,241,931 probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Zan T G 5: 137,425,562 I2692L unknown Het
Zfp142 C A 1: 74,585,520 E48D probably benign Het
Zfp598 T C 17: 24,677,530 Y194H probably damaging Het
Zfp85 T C 13: 67,748,945 N336S probably benign Het
Zfyve27 A T 19: 42,189,520 probably null Het
Zp3 T C 5: 135,982,705 S126P probably damaging Het
Other mutations in Fam60a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Fam60a APN 6 148928507 critical splice donor site probably null
R0637:Fam60a UTSW 6 148930665 intron probably benign
R0710:Fam60a UTSW 6 148933000 critical splice donor site probably null
R3788:Fam60a UTSW 6 148926119 missense possibly damaging 0.86
R3789:Fam60a UTSW 6 148926119 missense possibly damaging 0.86
R4896:Fam60a UTSW 6 148933000 critical splice donor site probably null
R5574:Fam60a UTSW 6 148944880 unclassified probably benign
R7922:Fam60a UTSW 6 148926146 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACCCAGGTATTAGAAACTAGTGG -3'
(R):5'- TACAGAGTAGTAGATCTGGGGC -3'

Sequencing Primer
(F):5'- TCCCATTGCTTTTCATGGAATTATC -3'
(R):5'- AGTAGATCTGGGGCGCCTTC -3'
Posted On2019-10-07