Incidental Mutation 'R7438:Dchs1'
ID 576738
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms 3110041P15Rik, C130033F22Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7438 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105752990-105787654 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105754948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2796 (I2796F)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: I2796F

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: I2796F

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,616,446 S425G probably benign Het
Adam29 A G 8: 55,871,574 I615T probably damaging Het
Arap2 A T 5: 62,749,475 I67N probably damaging Het
Asxl2 C T 12: 3,427,108 probably benign Het
Atp13a4 C T 16: 29,441,196 G607D Het
Atp2c2 G A 8: 119,748,197 V514M probably damaging Het
Baiap3 A G 17: 25,249,108 C311R possibly damaging Het
Becn1 A C 11: 101,294,226 S137R probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
C8a T C 4: 104,861,429 K110E probably damaging Het
Camta2 A G 11: 70,683,888 probably null Het
Capn8 T A 1: 182,598,675 Y192N probably damaging Het
Ccdc170 C T 10: 4,558,512 Q579* probably null Het
Cenpa G T 5: 30,666,948 probably benign Het
Cltc A G 11: 86,725,228 V404A probably benign Het
Cyp3a11 A T 5: 145,865,900 L261Q probably benign Het
Daw1 T A 1: 83,192,715 S249R probably benign Het
Dis3l2 T C 1: 86,745,500 probably null Het
Dnah5 A T 15: 28,346,952 D2527V probably damaging Het
Dsg4 G A 18: 20,466,628 R767Q probably damaging Het
Edaradd A G 13: 12,478,457 I118T probably damaging Het
Fam60a A G 6: 148,933,102 Y10H probably benign Het
Fam83h A G 15: 76,004,426 F354S possibly damaging Het
Fat3 A G 9: 15,988,482 V3085A probably benign Het
Fer A G 17: 64,133,521 D711G possibly damaging Het
G6pc G T 11: 101,376,677 V318F probably benign Het
Gal3st1 C A 11: 3,998,227 H145N probably benign Het
Gm13088 T C 4: 143,655,560 I189V probably damaging Het
Helz C T 11: 107,662,030 P1211S probably damaging Het
Herc1 A G 9: 66,394,756 I667V probably benign Het
Herc2 T A 7: 56,103,718 probably null Het
Hivep1 C T 13: 42,154,911 T209I probably damaging Het
Hsph1 A G 5: 149,619,020 Y678H probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ighv1-23 T C 12: 114,764,475 D109G probably damaging Het
Itgb3 T C 11: 104,643,577 V420A possibly damaging Het
Kcnk13 C A 12: 100,061,726 N353K probably damaging Het
Kif21a A G 15: 90,993,796 F270L probably benign Het
Kit T A 5: 75,639,000 V464D probably benign Het
Klhl36 G A 8: 119,870,175 W205* probably null Het
Krt17 A G 11: 100,258,465 Y260H probably damaging Het
Lats1 C T 10: 7,712,942 Q1108* probably null Het
Lrch1 G A 14: 74,757,037 T709I possibly damaging Het
Lrrc58 C A 16: 37,868,691 Q66K probably benign Het
Mei1 G A 15: 82,115,481 A664T Het
Mtmr6 C T 14: 60,300,304 T546M probably benign Het
Ncoa3 T A 2: 166,068,529 F1288L probably damaging Het
Nwd1 G T 8: 72,707,830 V1352L probably benign Het
Olfr1283 T A 2: 111,369,362 H243Q probably damaging Het
Olfr199 A T 16: 59,216,398 C72S probably benign Het
Ovol3 C T 7: 30,235,221 probably null Het
Palb2 C A 7: 122,117,331 V843L probably damaging Het
Pds5a T A 5: 65,652,535 probably null Het
Per1 A G 11: 69,104,735 S714G possibly damaging Het
Plch2 G A 4: 155,000,460 R442C probably damaging Het
Pon2 A T 6: 5,289,080 S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 N834Y probably damaging Het
Rbm46 C T 3: 82,842,488 W483* probably null Het
Rnd1 A T 15: 98,673,901 V88E probably damaging Het
Sbno2 T A 10: 80,069,575 T142S unknown Het
Scn9a C T 2: 66,547,187 V384M possibly damaging Het
Sertad4 T A 1: 192,846,710 H266L possibly damaging Het
Setd5 T A 6: 113,115,082 M288K possibly damaging Het
Sfxn4 T A 19: 60,857,361 N66Y probably damaging Het
Skint6 T A 4: 113,238,228 N78I probably damaging Het
Sltm G T 9: 70,573,466 G200V unknown Het
Smg1 A G 7: 118,195,893 I477T unknown Het
Supv3l1 C T 10: 62,430,470 probably null Het
Syne2 A G 12: 76,015,563 R4220G probably benign Het
Tbr1 A T 2: 61,804,817 H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Tmem231 G T 8: 111,918,408 S155R probably damaging Het
Trem3 A G 17: 48,258,470 *184W probably null Het
Trim33 T A 3: 103,346,640 probably benign Het
Tsen2 G A 6: 115,559,982 W233* probably null Het
Ttc21a T A 9: 119,945,539 N286K probably damaging Het
Tulp4 A T 17: 6,198,708 M194L probably benign Het
Ube3b C A 5: 114,415,284 R906S possibly damaging Het
Ube3b A C 5: 114,418,626 D1006A probably damaging Het
Vipas39 A T 12: 87,241,931 probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Zan T G 5: 137,425,562 I2692L unknown Het
Zfp142 C A 1: 74,585,520 E48D probably benign Het
Zfp598 T C 17: 24,677,530 Y194H probably damaging Het
Zfp85 T C 13: 67,748,945 N336S probably benign Het
Zfyve27 A T 19: 42,189,520 probably null Het
Zp3 T C 5: 135,982,705 S126P probably damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
R7821:Dchs1 UTSW 7 105765145 missense probably benign 0.00
R7834:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7841:Dchs1 UTSW 7 105762973 missense probably benign
R7913:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105755188 missense probably benign 0.45
R8076:Dchs1 UTSW 7 105755921 missense possibly damaging 0.52
R8076:Dchs1 UTSW 7 105761982 missense probably damaging 1.00
R8087:Dchs1 UTSW 7 105753499 missense probably benign 0.41
R8125:Dchs1 UTSW 7 105764882 missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105762617 missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105765511 missense probably benign 0.22
R8476:Dchs1 UTSW 7 105758808 missense probably benign 0.05
R8497:Dchs1 UTSW 7 105758961 missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105771738 missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105760857 missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105755390 missense probably benign 0.00
R8948:Dchs1 UTSW 7 105759005 missense probably benign 0.30
R8950:Dchs1 UTSW 7 105759005 missense probably benign 0.30
R9029:Dchs1 UTSW 7 105753712 missense probably benign 0.13
R9039:Dchs1 UTSW 7 105756008 missense probably benign 0.11
R9081:Dchs1 UTSW 7 105754429 missense probably benign 0.00
R9134:Dchs1 UTSW 7 105755703 missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105765919 missense probably benign
R9162:Dchs1 UTSW 7 105765525 missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105772907 missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105755626 missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105753913 missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105766195 missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105765774 critical splice donor site probably null
R9392:Dchs1 UTSW 7 105772662 missense probably benign 0.09
R9619:Dchs1 UTSW 7 105764455 missense probably benign 0.07
R9680:Dchs1 UTSW 7 105762418 missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105757984 missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105763475 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105757693 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105758551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCACCTGTTGTCTGGTTG -3'
(R):5'- CTGGGACTTTTGGTAGACTCC -3'

Sequencing Primer
(F):5'- AGCACCTGTTGTCTGGTTGATACC -3'
(R):5'- GACTTTTGGTAGACTCCGATATAGCC -3'
Posted On 2019-10-07