Incidental Mutation 'R7438:Sltm'
ID 576748
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene Name SAFB-like, transcription modulator
Synonyms 5730455C01Rik, 5730555F13Rik, 9130215G10Rik
MMRRC Submission 045514-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R7438 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 70450036-70499516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70480748 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 200 (G200V)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000213808] [ENSMUST00000216816] [ENSMUST00000217593]
AlphaFold Q8CH25
Predicted Effect unknown
Transcript: ENSMUST00000049263
AA Change: G200V
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: G200V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213808
Predicted Effect probably benign
Transcript: ENSMUST00000216816
Predicted Effect probably damaging
Transcript: ENSMUST00000217593
AA Change: G200V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,853,858 (GRCm39) S425G probably benign Het
Adam29 A G 8: 56,324,609 (GRCm39) I615T probably damaging Het
Arap2 A T 5: 62,906,818 (GRCm39) I67N probably damaging Het
Asxl2 C T 12: 3,477,108 (GRCm39) probably benign Het
Atp13a4 C T 16: 29,260,014 (GRCm39) G607D Het
Atp2c2 G A 8: 120,474,936 (GRCm39) V514M probably damaging Het
Baiap3 A G 17: 25,468,082 (GRCm39) C311R possibly damaging Het
Becn1 A C 11: 101,185,052 (GRCm39) S137R probably benign Het
C1qtnf6 G T 15: 78,409,574 (GRCm39) T91K probably benign Het
C8a T C 4: 104,718,626 (GRCm39) K110E probably damaging Het
Camta2 A G 11: 70,574,714 (GRCm39) probably null Het
Capn8 T A 1: 182,426,240 (GRCm39) Y192N probably damaging Het
Ccdc170 C T 10: 4,508,512 (GRCm39) Q579* probably null Het
Cenpa G T 5: 30,824,292 (GRCm39) probably benign Het
Cltc A G 11: 86,616,054 (GRCm39) V404A probably benign Het
Cyp3a11 A T 5: 145,802,710 (GRCm39) L261Q probably benign Het
Daw1 T A 1: 83,170,436 (GRCm39) S249R probably benign Het
Dchs1 T A 7: 105,404,155 (GRCm39) I2796F probably benign Het
Dis3l2 T C 1: 86,673,222 (GRCm39) probably null Het
Dnah5 A T 15: 28,347,098 (GRCm39) D2527V probably damaging Het
Dsg4 G A 18: 20,599,685 (GRCm39) R767Q probably damaging Het
Edaradd A G 13: 12,493,338 (GRCm39) I118T probably damaging Het
Fam83h A G 15: 75,876,275 (GRCm39) F354S possibly damaging Het
Fat3 A G 9: 15,899,778 (GRCm39) V3085A probably benign Het
Fer A G 17: 64,440,516 (GRCm39) D711G possibly damaging Het
G6pc1 G T 11: 101,267,503 (GRCm39) V318F probably benign Het
Gal3st1 C A 11: 3,948,227 (GRCm39) H145N probably benign Het
Helz C T 11: 107,552,856 (GRCm39) P1211S probably damaging Het
Herc1 A G 9: 66,302,038 (GRCm39) I667V probably benign Het
Herc2 T A 7: 55,753,466 (GRCm39) probably null Het
Hivep1 C T 13: 42,308,387 (GRCm39) T209I probably damaging Het
Hsph1 A G 5: 149,542,485 (GRCm39) Y678H probably damaging Het
Ift122 C T 6: 115,903,263 (GRCm39) R1176C probably benign Het
Ighv1-23 T C 12: 114,728,095 (GRCm39) D109G probably damaging Het
Itgb3 T C 11: 104,534,403 (GRCm39) V420A possibly damaging Het
Kcnk13 C A 12: 100,027,985 (GRCm39) N353K probably damaging Het
Kif21a A G 15: 90,877,999 (GRCm39) F270L probably benign Het
Kit T A 5: 75,799,660 (GRCm39) V464D probably benign Het
Klhl36 G A 8: 120,596,914 (GRCm39) W205* probably null Het
Krt17 A G 11: 100,149,291 (GRCm39) Y260H probably damaging Het
Lats1 C T 10: 7,588,706 (GRCm39) Q1108* probably null Het
Lrch1 G A 14: 74,994,477 (GRCm39) T709I possibly damaging Het
Lrrc58 C A 16: 37,689,053 (GRCm39) Q66K probably benign Het
Mei1 G A 15: 81,999,682 (GRCm39) A664T Het
Mtmr6 C T 14: 60,537,753 (GRCm39) T546M probably benign Het
Ncoa3 T A 2: 165,910,449 (GRCm39) F1288L probably damaging Het
Nwd1 G T 8: 73,434,458 (GRCm39) V1352L probably benign Het
Or4k77 T A 2: 111,199,707 (GRCm39) H243Q probably damaging Het
Or5ac17 A T 16: 59,036,761 (GRCm39) C72S probably benign Het
Ovol3 C T 7: 29,934,646 (GRCm39) probably null Het
Palb2 C A 7: 121,716,554 (GRCm39) V843L probably damaging Het
Pds5a T A 5: 65,809,878 (GRCm39) probably null Het
Per1 A G 11: 68,995,561 (GRCm39) S714G possibly damaging Het
Plch2 G A 4: 155,084,917 (GRCm39) R442C probably damaging Het
Pon2 A T 6: 5,289,080 (GRCm39) S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 (GRCm39) N834Y probably damaging Het
Pramel22 T C 4: 143,382,130 (GRCm39) I189V probably damaging Het
Rbm46 C T 3: 82,749,795 (GRCm39) W483* probably null Het
Rnd1 A T 15: 98,571,782 (GRCm39) V88E probably damaging Het
Sbno2 T A 10: 79,905,409 (GRCm39) T142S unknown Het
Scn9a C T 2: 66,377,531 (GRCm39) V384M possibly damaging Het
Sertad4 T A 1: 192,529,018 (GRCm39) H266L possibly damaging Het
Setd5 T A 6: 113,092,043 (GRCm39) M288K possibly damaging Het
Sfxn4 T A 19: 60,845,799 (GRCm39) N66Y probably damaging Het
Sinhcaf A G 6: 148,834,600 (GRCm39) Y10H probably benign Het
Skint6 T A 4: 113,095,425 (GRCm39) N78I probably damaging Het
Smg1 A G 7: 117,795,116 (GRCm39) I477T unknown Het
Supv3l1 C T 10: 62,266,249 (GRCm39) probably null Het
Syne2 A G 12: 76,062,337 (GRCm39) R4220G probably benign Het
Tbr1 A T 2: 61,635,161 (GRCm39) H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,345,211 (GRCm39) probably benign Het
Tmem231 G T 8: 112,645,040 (GRCm39) S155R probably damaging Het
Trem3 A G 17: 48,565,498 (GRCm39) *184W probably null Het
Trim33 T A 3: 103,253,956 (GRCm39) probably benign Het
Tsen2 G A 6: 115,536,943 (GRCm39) W233* probably null Het
Ttc21a T A 9: 119,774,605 (GRCm39) N286K probably damaging Het
Tulp4 A T 17: 6,248,983 (GRCm39) M194L probably benign Het
Ube3b C A 5: 114,553,345 (GRCm39) R906S possibly damaging Het
Ube3b A C 5: 114,556,687 (GRCm39) D1006A probably damaging Het
Vipas39 A T 12: 87,288,705 (GRCm39) probably null Het
Wdr35 T A 12: 9,072,785 (GRCm39) Y920N probably damaging Het
Zan T G 5: 137,423,824 (GRCm39) I2692L unknown Het
Zfp142 C A 1: 74,624,679 (GRCm39) E48D probably benign Het
Zfp598 T C 17: 24,896,504 (GRCm39) Y194H probably damaging Het
Zfp85 T C 13: 67,897,064 (GRCm39) N336S probably benign Het
Zfyve27 A T 19: 42,177,959 (GRCm39) probably null Het
Zp3 T C 5: 136,011,559 (GRCm39) S126P probably damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70,486,624 (GRCm39) missense probably damaging 1.00
IGL01755:Sltm APN 9 70,491,204 (GRCm39) splice site probably null
IGL01782:Sltm APN 9 70,480,923 (GRCm39) missense probably damaging 1.00
IGL02441:Sltm APN 9 70,494,467 (GRCm39) missense probably damaging 1.00
IGL02831:Sltm APN 9 70,492,147 (GRCm39) missense probably damaging 1.00
IGL02947:Sltm APN 9 70,498,946 (GRCm39) missense probably benign 0.05
IGL03166:Sltm APN 9 70,450,251 (GRCm39) missense possibly damaging 0.87
R0288:Sltm UTSW 9 70,486,633 (GRCm39) missense probably damaging 1.00
R0555:Sltm UTSW 9 70,493,363 (GRCm39) missense probably damaging 1.00
R0815:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R0863:Sltm UTSW 9 70,469,190 (GRCm39) missense probably benign 0.04
R1315:Sltm UTSW 9 70,450,347 (GRCm39) missense probably benign 0.13
R1533:Sltm UTSW 9 70,493,948 (GRCm39) missense probably damaging 1.00
R1676:Sltm UTSW 9 70,480,929 (GRCm39) missense probably damaging 1.00
R1764:Sltm UTSW 9 70,469,082 (GRCm39) missense probably benign 0.00
R1845:Sltm UTSW 9 70,450,314 (GRCm39) missense possibly damaging 0.60
R2049:Sltm UTSW 9 70,488,583 (GRCm39) missense probably benign 0.00
R2163:Sltm UTSW 9 70,498,964 (GRCm39) missense probably damaging 0.99
R3410:Sltm UTSW 9 70,493,240 (GRCm39) missense probably damaging 0.97
R4323:Sltm UTSW 9 70,487,529 (GRCm39) missense probably benign
R4632:Sltm UTSW 9 70,486,651 (GRCm39) missense possibly damaging 0.86
R4748:Sltm UTSW 9 70,488,647 (GRCm39) missense probably damaging 1.00
R4756:Sltm UTSW 9 70,498,892 (GRCm39) missense possibly damaging 0.57
R4782:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4799:Sltm UTSW 9 70,496,339 (GRCm39) missense probably damaging 1.00
R4887:Sltm UTSW 9 70,496,260 (GRCm39) missense probably damaging 1.00
R5221:Sltm UTSW 9 70,486,685 (GRCm39) missense probably damaging 1.00
R5263:Sltm UTSW 9 70,492,081 (GRCm39) missense unknown
R5982:Sltm UTSW 9 70,494,086 (GRCm39) missense probably damaging 1.00
R6297:Sltm UTSW 9 70,488,641 (GRCm39) missense probably damaging 0.99
R6456:Sltm UTSW 9 70,450,269 (GRCm39) missense probably damaging 1.00
R6658:Sltm UTSW 9 70,488,644 (GRCm39) missense probably damaging 1.00
R6720:Sltm UTSW 9 70,480,992 (GRCm39) missense probably damaging 1.00
R6770:Sltm UTSW 9 70,492,059 (GRCm39) missense unknown
R6923:Sltm UTSW 9 70,481,892 (GRCm39) missense probably damaging 1.00
R7051:Sltm UTSW 9 70,466,348 (GRCm39) missense probably damaging 1.00
R7166:Sltm UTSW 9 70,492,132 (GRCm39) missense probably damaging 1.00
R7257:Sltm UTSW 9 70,451,247 (GRCm39) splice site probably null
R7400:Sltm UTSW 9 70,493,352 (GRCm39) missense probably damaging 1.00
R7484:Sltm UTSW 9 70,481,179 (GRCm39) missense unknown
R7630:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7631:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7632:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7633:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7862:Sltm UTSW 9 70,479,446 (GRCm39) nonsense probably null
R7885:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7886:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7888:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7889:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7891:Sltm UTSW 9 70,493,955 (GRCm39) missense possibly damaging 0.94
R7915:Sltm UTSW 9 70,494,431 (GRCm39) missense probably damaging 1.00
R8030:Sltm UTSW 9 70,493,261 (GRCm39) nonsense probably null
R8062:Sltm UTSW 9 70,480,779 (GRCm39) missense unknown
R8099:Sltm UTSW 9 70,493,360 (GRCm39) missense probably damaging 1.00
R8374:Sltm UTSW 9 70,469,227 (GRCm39) missense probably null
R8698:Sltm UTSW 9 70,494,352 (GRCm39) missense probably benign 0.27
R9541:Sltm UTSW 9 70,481,057 (GRCm39) missense unknown
R9563:Sltm UTSW 9 70,480,841 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GATGGATCCTCTCTCACTGTTGTTG -3'
(R):5'- CCAGAGTGATGGCATCTTCAG -3'

Sequencing Primer
(F):5'- CCCCCGAAGAATAAGTGATCTTAGG -3'
(R):5'- GCATCTTCAGCCTGGATTGTGAC -3'
Posted On 2019-10-07