Mutagenetix > Incidental Mutation

Incidental Mutation 'R7438:Lats1'

576751

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

045514-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R7438 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 7712942 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1108 (Q1108*)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably null
Transcript: ENSMUST00000040043
AA Change: Q1108*

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: Q1108*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165952
AA Change: Q1108*

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: Q1108*

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000217931
AA Change: Q1108*

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	T	C	14: 118,616,446	S425G	probably benign	Het
Adam29	A	G	8: 55,871,574	I615T	probably damaging	Het
Arap2	A	T	5: 62,749,475	I67N	probably damaging	Het
Asxl2	C	T	12: 3,427,108		probably benign	Het
Atp13a4	C	T	16: 29,441,196	G607D		Het
Atp2c2	G	A	8: 119,748,197	V514M	probably damaging	Het
Baiap3	A	G	17: 25,249,108	C311R	possibly damaging	Het
Becn1	A	C	11: 101,294,226	S137R	probably benign	Het
C1qtnf6	G	T	15: 78,525,374	T91K	probably benign	Het
C8a	T	C	4: 104,861,429	K110E	probably damaging	Het
Camta2	A	G	11: 70,683,888		probably null	Het
Capn8	T	A	1: 182,598,675	Y192N	probably damaging	Het
Ccdc170	C	T	10: 4,558,512	Q579*	probably null	Het
Cenpa	G	T	5: 30,666,948		probably benign	Het
Cltc	A	G	11: 86,725,228	V404A	probably benign	Het
Cyp3a11	A	T	5: 145,865,900	L261Q	probably benign	Het
Daw1	T	A	1: 83,192,715	S249R	probably benign	Het
Dchs1	T	A	7: 105,754,948	I2796F	probably benign	Het
Dis3l2	T	C	1: 86,745,500		probably null	Het
Dnah5	A	T	15: 28,346,952	D2527V	probably damaging	Het
Dsg4	G	A	18: 20,466,628	R767Q	probably damaging	Het
Edaradd	A	G	13: 12,478,457	I118T	probably damaging	Het
Fam60a	A	G	6: 148,933,102	Y10H	probably benign	Het
Fam83h	A	G	15: 76,004,426	F354S	possibly damaging	Het
Fat3	A	G	9: 15,988,482	V3085A	probably benign	Het
Fer	A	G	17: 64,133,521	D711G	possibly damaging	Het
G6pc	G	T	11: 101,376,677	V318F	probably benign	Het
Gal3st1	C	A	11: 3,998,227	H145N	probably benign	Het
Gm13088	T	C	4: 143,655,560	I189V	probably damaging	Het
Helz	C	T	11: 107,662,030	P1211S	probably damaging	Het
Herc1	A	G	9: 66,394,756	I667V	probably benign	Het
Herc2	T	A	7: 56,103,718		probably null	Het
Hivep1	C	T	13: 42,154,911	T209I	probably damaging	Het
Hsph1	A	G	5: 149,619,020	Y678H	probably damaging	Het
Ift122	C	T	6: 115,926,302	R1176C	probably benign	Het
Ighv1-23	T	C	12: 114,764,475	D109G	probably damaging	Het
Itgb3	T	C	11: 104,643,577	V420A	possibly damaging	Het
Kcnk13	C	A	12: 100,061,726	N353K	probably damaging	Het
Kif21a	A	G	15: 90,993,796	F270L	probably benign	Het
Kit	T	A	5: 75,639,000	V464D	probably benign	Het
Klhl36	G	A	8: 119,870,175	W205*	probably null	Het
Krt17	A	G	11: 100,258,465	Y260H	probably damaging	Het
Lrch1	G	A	14: 74,757,037	T709I	possibly damaging	Het
Lrrc58	C	A	16: 37,868,691	Q66K	probably benign	Het
Mei1	G	A	15: 82,115,481	A664T		Het
Mtmr6	C	T	14: 60,300,304	T546M	probably benign	Het
Ncoa3	T	A	2: 166,068,529	F1288L	probably damaging	Het
Nwd1	G	T	8: 72,707,830	V1352L	probably benign	Het
Olfr1283	T	A	2: 111,369,362	H243Q	probably damaging	Het
Olfr199	A	T	16: 59,216,398	C72S	probably benign	Het
Ovol3	C	T	7: 30,235,221		probably null	Het
Palb2	C	A	7: 122,117,331	V843L	probably damaging	Het
Pds5a	T	A	5: 65,652,535		probably null	Het
Per1	A	G	11: 69,104,735	S714G	possibly damaging	Het
Plch2	G	A	4: 155,000,460	R442C	probably damaging	Het
Pon2	A	T	6: 5,289,080	S26R	probably benign	Het
Ppp1r9a	A	T	6: 5,115,378	N834Y	probably damaging	Het
Rbm46	C	T	3: 82,842,488	W483*	probably null	Het
Rnd1	A	T	15: 98,673,901	V88E	probably damaging	Het
Sbno2	T	A	10: 80,069,575	T142S	unknown	Het
Scn9a	C	T	2: 66,547,187	V384M	possibly damaging	Het
Sertad4	T	A	1: 192,846,710	H266L	possibly damaging	Het
Setd5	T	A	6: 113,115,082	M288K	possibly damaging	Het
Sfxn4	T	A	19: 60,857,361	N66Y	probably damaging	Het
Skint6	T	A	4: 113,238,228	N78I	probably damaging	Het
Sltm	G	T	9: 70,573,466	G200V	unknown	Het
Smg1	A	G	7: 118,195,893	I477T	unknown	Het
Supv3l1	C	T	10: 62,430,470		probably null	Het
Syne2	A	G	12: 76,015,563	R4220G	probably benign	Het
Tbr1	A	T	2: 61,804,817	H37L	possibly damaging	Het
Tet3	TGGCCCAGGCCCAGGC	TGGCCCAGGCCCAGGCCCAGGC	6: 83,368,229		probably benign	Het
Tmem231	G	T	8: 111,918,408	S155R	probably damaging	Het
Trem3	A	G	17: 48,258,470	*184W	probably null	Het
Trim33	T	A	3: 103,346,640		probably benign	Het
Tsen2	G	A	6: 115,559,982	W233*	probably null	Het
Ttc21a	T	A	9: 119,945,539	N286K	probably damaging	Het
Tulp4	A	T	17: 6,198,708	M194L	probably benign	Het
Ube3b	C	A	5: 114,415,284	R906S	possibly damaging	Het
Ube3b	A	C	5: 114,418,626	D1006A	probably damaging	Het
Vipas39	A	T	12: 87,241,931		probably null	Het
Wdr35	T	A	12: 9,022,785	Y920N	probably damaging	Het
Zan	T	G	5: 137,425,562	I2692L	unknown	Het
Zfp142	C	A	1: 74,585,520	E48D	probably benign	Het
Zfp598	T	C	17: 24,677,530	Y194H	probably damaging	Het
Zfp85	T	C	13: 67,748,945	N336S	probably benign	Het
Zfyve27	A	T	19: 42,189,520		probably null	Het
Zp3	T	C	5: 135,982,705	S126P	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTGTGGAGCGATGGCAGC -3'
(R):5'- AGCGTATTGGGAACTAAACCC -3'

Sequencing Primer
(F):5'- CGAGGAGGAAAATATCAGTGACACTC -3'
(R):5'- CAGGCTTCTCTTTTTAAACAGAGCAC -3'

Posted On

2019-10-07