Incidental Mutation 'R7438:Gal3st1'
ID 576754
Institutional Source Beutler Lab
Gene Symbol Gal3st1
Ensembl Gene ENSMUSG00000049721
Gene Name galactose-3-O-sulfotransferase 1
Synonyms GalCer sulfotransferase, Gcst, Cst, galactosylceramide sulfotransferase, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7438 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 3983636-3999326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 3998227 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 145 (H145N)
Ref Sequence ENSEMBL: ENSMUSP00000058348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109981]
AlphaFold Q9JHE4
Predicted Effect probably benign
Transcript: ENSMUST00000063004
AA Change: H145N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721
AA Change: H145N

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078757
AA Change: H145N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721
AA Change: H145N

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109981
AA Change: H145N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105608
Gene: ENSMUSG00000049721
AA Change: H145N

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. This gene encodes galactosylceramide sulfotransferase, which catalyzes the sulfation of membrane glycolipids including the final step in the synthesis of sulfatide, a major lipid component of the myelin sheath. This gene exhibits elevated expression in ovarian epithelial carcinoma and the encoded enzyme exhibits elevated activity in renal cell carcinoma. Mutations in this gene may be associated with reduced insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hindlimb weakness and progressive ataxia beginning at six weeks of age. Homozygous males exhibit sterility with a block in spermatogenesis prior to the first meiotic division. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,616,446 S425G probably benign Het
Adam29 A G 8: 55,871,574 I615T probably damaging Het
Arap2 A T 5: 62,749,475 I67N probably damaging Het
Asxl2 C T 12: 3,427,108 probably benign Het
Atp13a4 C T 16: 29,441,196 G607D Het
Atp2c2 G A 8: 119,748,197 V514M probably damaging Het
Baiap3 A G 17: 25,249,108 C311R possibly damaging Het
Becn1 A C 11: 101,294,226 S137R probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
C8a T C 4: 104,861,429 K110E probably damaging Het
Camta2 A G 11: 70,683,888 probably null Het
Capn8 T A 1: 182,598,675 Y192N probably damaging Het
Ccdc170 C T 10: 4,558,512 Q579* probably null Het
Cenpa G T 5: 30,666,948 probably benign Het
Cltc A G 11: 86,725,228 V404A probably benign Het
Cyp3a11 A T 5: 145,865,900 L261Q probably benign Het
Daw1 T A 1: 83,192,715 S249R probably benign Het
Dchs1 T A 7: 105,754,948 I2796F probably benign Het
Dis3l2 T C 1: 86,745,500 probably null Het
Dnah5 A T 15: 28,346,952 D2527V probably damaging Het
Dsg4 G A 18: 20,466,628 R767Q probably damaging Het
Edaradd A G 13: 12,478,457 I118T probably damaging Het
Fam60a A G 6: 148,933,102 Y10H probably benign Het
Fam83h A G 15: 76,004,426 F354S possibly damaging Het
Fat3 A G 9: 15,988,482 V3085A probably benign Het
Fer A G 17: 64,133,521 D711G possibly damaging Het
G6pc G T 11: 101,376,677 V318F probably benign Het
Gm13088 T C 4: 143,655,560 I189V probably damaging Het
Helz C T 11: 107,662,030 P1211S probably damaging Het
Herc1 A G 9: 66,394,756 I667V probably benign Het
Herc2 T A 7: 56,103,718 probably null Het
Hivep1 C T 13: 42,154,911 T209I probably damaging Het
Hsph1 A G 5: 149,619,020 Y678H probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ighv1-23 T C 12: 114,764,475 D109G probably damaging Het
Itgb3 T C 11: 104,643,577 V420A possibly damaging Het
Kcnk13 C A 12: 100,061,726 N353K probably damaging Het
Kif21a A G 15: 90,993,796 F270L probably benign Het
Kit T A 5: 75,639,000 V464D probably benign Het
Klhl36 G A 8: 119,870,175 W205* probably null Het
Krt17 A G 11: 100,258,465 Y260H probably damaging Het
Lats1 C T 10: 7,712,942 Q1108* probably null Het
Lrch1 G A 14: 74,757,037 T709I possibly damaging Het
Lrrc58 C A 16: 37,868,691 Q66K probably benign Het
Mei1 G A 15: 82,115,481 A664T Het
Mtmr6 C T 14: 60,300,304 T546M probably benign Het
Ncoa3 T A 2: 166,068,529 F1288L probably damaging Het
Nwd1 G T 8: 72,707,830 V1352L probably benign Het
Olfr1283 T A 2: 111,369,362 H243Q probably damaging Het
Olfr199 A T 16: 59,216,398 C72S probably benign Het
Ovol3 C T 7: 30,235,221 probably null Het
Palb2 C A 7: 122,117,331 V843L probably damaging Het
Pds5a T A 5: 65,652,535 probably null Het
Per1 A G 11: 69,104,735 S714G possibly damaging Het
Plch2 G A 4: 155,000,460 R442C probably damaging Het
Pon2 A T 6: 5,289,080 S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 N834Y probably damaging Het
Rbm46 C T 3: 82,842,488 W483* probably null Het
Rnd1 A T 15: 98,673,901 V88E probably damaging Het
Sbno2 T A 10: 80,069,575 T142S unknown Het
Scn9a C T 2: 66,547,187 V384M possibly damaging Het
Sertad4 T A 1: 192,846,710 H266L possibly damaging Het
Setd5 T A 6: 113,115,082 M288K possibly damaging Het
Sfxn4 T A 19: 60,857,361 N66Y probably damaging Het
Skint6 T A 4: 113,238,228 N78I probably damaging Het
Sltm G T 9: 70,573,466 G200V unknown Het
Smg1 A G 7: 118,195,893 I477T unknown Het
Supv3l1 C T 10: 62,430,470 probably null Het
Syne2 A G 12: 76,015,563 R4220G probably benign Het
Tbr1 A T 2: 61,804,817 H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Tmem231 G T 8: 111,918,408 S155R probably damaging Het
Trem3 A G 17: 48,258,470 *184W probably null Het
Trim33 T A 3: 103,346,640 probably benign Het
Tsen2 G A 6: 115,559,982 W233* probably null Het
Ttc21a T A 9: 119,945,539 N286K probably damaging Het
Tulp4 A T 17: 6,198,708 M194L probably benign Het
Ube3b C A 5: 114,415,284 R906S possibly damaging Het
Ube3b A C 5: 114,418,626 D1006A probably damaging Het
Vipas39 A T 12: 87,241,931 probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Zan T G 5: 137,425,562 I2692L unknown Het
Zfp142 C A 1: 74,585,520 E48D probably benign Het
Zfp598 T C 17: 24,677,530 Y194H probably damaging Het
Zfp85 T C 13: 67,748,945 N336S probably benign Het
Zfyve27 A T 19: 42,189,520 probably null Het
Zp3 T C 5: 135,982,705 S126P probably damaging Het
Other mutations in Gal3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gal3st1 APN 11 3999070 utr 3 prime probably benign
IGL01010:Gal3st1 APN 11 3996914 utr 5 prime probably benign
IGL01079:Gal3st1 APN 11 3998564 missense probably damaging 1.00
IGL01306:Gal3st1 APN 11 3998405 missense probably damaging 1.00
IGL01614:Gal3st1 APN 11 3998996 missense probably damaging 1.00
IGL01990:Gal3st1 APN 11 3998741 missense probably damaging 1.00
IGL02439:Gal3st1 APN 11 3998110 missense possibly damaging 0.95
R0306:Gal3st1 UTSW 11 3998546 missense probably damaging 1.00
R1075:Gal3st1 UTSW 11 3998509 missense possibly damaging 0.80
R1171:Gal3st1 UTSW 11 3998931 missense probably damaging 1.00
R1874:Gal3st1 UTSW 11 3998231 missense probably damaging 1.00
R2230:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2231:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2232:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2985:Gal3st1 UTSW 11 3998618 missense probably damaging 1.00
R3552:Gal3st1 UTSW 11 3998110 missense possibly damaging 0.90
R6737:Gal3st1 UTSW 11 3998903 missense probably benign 0.00
R7027:Gal3st1 UTSW 11 3999002 missense probably damaging 0.96
R7106:Gal3st1 UTSW 11 3998509 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998609 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998651 missense probably damaging 0.98
R7290:Gal3st1 UTSW 11 3998093 missense possibly damaging 0.70
R7934:Gal3st1 UTSW 11 3998405 missense probably damaging 1.00
R9046:Gal3st1 UTSW 11 3998278 missense probably benign 0.05
R9475:Gal3st1 UTSW 11 3998660 missense probably damaging 1.00
RF020:Gal3st1 UTSW 11 3998153 missense possibly damaging 0.75
Z1088:Gal3st1 UTSW 11 3997984 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACACTGCTCAACATCCTG -3'
(R):5'- TATCATAGCCCAGATCGAAGAAG -3'

Sequencing Primer
(F):5'- ACTGCTCAACATCCTGTTCCG -3'
(R):5'- CTCGGGTCGTAGTAGCGATC -3'
Posted On 2019-10-07