Incidental Mutation 'R7438:G6pc'
ID576759
Institutional Source Beutler Lab
Gene Symbol G6pc
Ensembl Gene ENSMUSG00000078650
Gene Nameglucose-6-phosphatase, catalytic
SynonymsGlc-6-Pase, G6Pase, G6pt, Glc-6-Pase-alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7438 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101367561-101377903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101376677 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 318 (V318F)
Ref Sequence ENSEMBL: ENSMUSP00000019469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019469]
Predicted Effect probably benign
Transcript: ENSMUST00000019469
AA Change: V318F

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000019469
Gene: ENSMUSG00000078650
AA Change: V318F

DomainStartEndE-ValueType
acidPPc 56 196 2.28e-40 SMART
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 256 278 N/A INTRINSIC
transmembrane domain 291 308 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: The enzyme encoded by this gene is a multisubunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for glucose-6-phosphate, inorganic phosphate, and glucose. This gene is one of three glucose-6-phosphatase catalytic-subunit-encoding genes in mouse. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene tend to die within a couple of weeks of weaning. Blood chemistry and glucose metabolism are abnormal as is glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,616,446 S425G probably benign Het
Adam29 A G 8: 55,871,574 I615T probably damaging Het
Arap2 A T 5: 62,749,475 I67N probably damaging Het
Asxl2 C T 12: 3,427,108 probably benign Het
Atp13a4 C T 16: 29,441,196 G607D Het
Atp2c2 G A 8: 119,748,197 V514M probably damaging Het
Baiap3 A G 17: 25,249,108 C311R possibly damaging Het
Becn1 A C 11: 101,294,226 S137R probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
C8a T C 4: 104,861,429 K110E probably damaging Het
Camta2 A G 11: 70,683,888 probably null Het
Capn8 T A 1: 182,598,675 Y192N probably damaging Het
Ccdc170 C T 10: 4,558,512 Q579* probably null Het
Cenpa G T 5: 30,666,948 probably benign Het
Cltc A G 11: 86,725,228 V404A probably benign Het
Cyp3a11 A T 5: 145,865,900 L261Q probably benign Het
Daw1 T A 1: 83,192,715 S249R probably benign Het
Dchs1 T A 7: 105,754,948 I2796F probably benign Het
Dis3l2 T C 1: 86,745,500 probably null Het
Dnah5 A T 15: 28,346,952 D2527V probably damaging Het
Dsg4 G A 18: 20,466,628 R767Q probably damaging Het
Edaradd A G 13: 12,478,457 I118T probably damaging Het
Fam60a A G 6: 148,933,102 Y10H probably benign Het
Fam83h A G 15: 76,004,426 F354S possibly damaging Het
Fat3 A G 9: 15,988,482 V3085A probably benign Het
Fer A G 17: 64,133,521 D711G possibly damaging Het
Gal3st1 C A 11: 3,998,227 H145N probably benign Het
Gm13088 T C 4: 143,655,560 I189V probably damaging Het
Helz C T 11: 107,662,030 P1211S probably damaging Het
Herc1 A G 9: 66,394,756 I667V probably benign Het
Herc2 T A 7: 56,103,718 probably null Het
Hivep1 C T 13: 42,154,911 T209I probably damaging Het
Hsph1 A G 5: 149,619,020 Y678H probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ighv1-23 T C 12: 114,764,475 D109G probably damaging Het
Itgb3 T C 11: 104,643,577 V420A possibly damaging Het
Kcnk13 C A 12: 100,061,726 N353K probably damaging Het
Kif21a A G 15: 90,993,796 F270L probably benign Het
Kit T A 5: 75,639,000 V464D probably benign Het
Klhl36 G A 8: 119,870,175 W205* probably null Het
Krt17 A G 11: 100,258,465 Y260H probably damaging Het
Lats1 C T 10: 7,712,942 Q1108* probably null Het
Lrch1 G A 14: 74,757,037 T709I possibly damaging Het
Lrrc58 C A 16: 37,868,691 Q66K probably benign Het
Mei1 G A 15: 82,115,481 A664T Het
Mtmr6 C T 14: 60,300,304 T546M probably benign Het
Ncoa3 T A 2: 166,068,529 F1288L probably damaging Het
Nwd1 G T 8: 72,707,830 V1352L probably benign Het
Olfr1283 T A 2: 111,369,362 H243Q probably damaging Het
Olfr199 A T 16: 59,216,398 C72S probably benign Het
Ovol3 C T 7: 30,235,221 probably null Het
Palb2 C A 7: 122,117,331 V843L probably damaging Het
Pds5a T A 5: 65,652,535 probably null Het
Per1 A G 11: 69,104,735 S714G possibly damaging Het
Plch2 G A 4: 155,000,460 R442C probably damaging Het
Pon2 A T 6: 5,289,080 S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 N834Y probably damaging Het
Rbm46 C T 3: 82,842,488 W483* probably null Het
Rnd1 A T 15: 98,673,901 V88E probably damaging Het
Sbno2 T A 10: 80,069,575 T142S unknown Het
Scn9a C T 2: 66,547,187 V384M possibly damaging Het
Sertad4 T A 1: 192,846,710 H266L possibly damaging Het
Setd5 T A 6: 113,115,082 M288K possibly damaging Het
Sfxn4 T A 19: 60,857,361 N66Y probably damaging Het
Skint6 T A 4: 113,238,228 N78I probably damaging Het
Sltm G T 9: 70,573,466 G200V unknown Het
Smg1 A G 7: 118,195,893 I477T unknown Het
Supv3l1 C T 10: 62,430,470 probably null Het
Syne2 A G 12: 76,015,563 R4220G probably benign Het
Tbr1 A T 2: 61,804,817 H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Tmem231 G T 8: 111,918,408 S155R probably damaging Het
Trem3 A G 17: 48,258,470 *184W probably null Het
Trim33 T A 3: 103,346,640 probably benign Het
Tsen2 G A 6: 115,559,982 W233* probably null Het
Ttc21a T A 9: 119,945,539 N286K probably damaging Het
Tulp4 A T 17: 6,198,708 M194L probably benign Het
Ube3b C A 5: 114,415,284 R906S possibly damaging Het
Ube3b A C 5: 114,418,626 D1006A probably damaging Het
Vipas39 A T 12: 87,241,931 probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Zan T G 5: 137,425,562 I2692L unknown Het
Zfp142 C A 1: 74,585,520 E48D probably benign Het
Zfp598 T C 17: 24,677,530 Y194H probably damaging Het
Zfp85 T C 13: 67,748,945 N336S probably benign Het
Zfyve27 A T 19: 42,189,520 probably null Het
Zp3 T C 5: 135,982,705 S126P probably damaging Het
Other mutations in G6pc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:G6pc APN 11 101370723 missense probably damaging 1.00
IGL03068:G6pc APN 11 101370750 missense probably benign 0.01
R1988:G6pc UTSW 11 101367942 missense probably damaging 0.97
R3936:G6pc UTSW 11 101374603 missense probably benign
R4601:G6pc UTSW 11 101372741 missense probably damaging 1.00
R4677:G6pc UTSW 11 101376613 missense probably benign
R6073:G6pc UTSW 11 101367976 missense probably benign
R6304:G6pc UTSW 11 101367909 missense probably damaging 1.00
R7103:G6pc UTSW 11 101374587 splice site probably null
R7143:G6pc UTSW 11 101370723 missense probably damaging 1.00
R7499:G6pc UTSW 11 101376694 nonsense probably null
R7960:G6pc UTSW 11 101376533 missense probably damaging 1.00
R8339:G6pc UTSW 11 101376488 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGACACTACACCCTTTGCCAG -3'
(R):5'- CCTCACAATGGGTTTCAGAGG -3'

Sequencing Primer
(F):5'- AGCCTCTTCAAAAACCTGGG -3'
(R):5'- CTCACAATGGGTTTCAGAGGCTTTAG -3'
Posted On2019-10-07