Incidental Mutation 'R7438:Asxl2'
ID576762
Institutional Source Beutler Lab
Gene Symbol Asxl2
Ensembl Gene ENSMUSG00000037486
Gene Nameadditional sex combs like 2, transcriptional regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R7438 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location3426857-3506852 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 3427108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000144247] [ENSMUST00000153102]
Predicted Effect probably benign
Transcript: ENSMUST00000092003
SMART Domains Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.2e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111215
SMART Domains Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 3.6e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 4.2e-52 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1305 1368 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144247
SMART Domains Protein: ENSMUSP00000116048
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 5.2e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
low complexity region 221 244 N/A INTRINSIC
Pfam:ASXH 252 384 7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153102
SMART Domains Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 211 335 6.9e-38 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1308 1368 7.6e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,616,446 S425G probably benign Het
Adam29 A G 8: 55,871,574 I615T probably damaging Het
Arap2 A T 5: 62,749,475 I67N probably damaging Het
Atp13a4 C T 16: 29,441,196 G607D Het
Atp2c2 G A 8: 119,748,197 V514M probably damaging Het
Baiap3 A G 17: 25,249,108 C311R possibly damaging Het
Becn1 A C 11: 101,294,226 S137R probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
C8a T C 4: 104,861,429 K110E probably damaging Het
Camta2 A G 11: 70,683,888 probably null Het
Capn8 T A 1: 182,598,675 Y192N probably damaging Het
Ccdc170 C T 10: 4,558,512 Q579* probably null Het
Cenpa G T 5: 30,666,948 probably benign Het
Cltc A G 11: 86,725,228 V404A probably benign Het
Cyp3a11 A T 5: 145,865,900 L261Q probably benign Het
Daw1 T A 1: 83,192,715 S249R probably benign Het
Dchs1 T A 7: 105,754,948 I2796F probably benign Het
Dis3l2 T C 1: 86,745,500 probably null Het
Dnah5 A T 15: 28,346,952 D2527V probably damaging Het
Dsg4 G A 18: 20,466,628 R767Q probably damaging Het
Edaradd A G 13: 12,478,457 I118T probably damaging Het
Fam60a A G 6: 148,933,102 Y10H probably benign Het
Fam83h A G 15: 76,004,426 F354S possibly damaging Het
Fat3 A G 9: 15,988,482 V3085A probably benign Het
Fer A G 17: 64,133,521 D711G possibly damaging Het
G6pc G T 11: 101,376,677 V318F probably benign Het
Gal3st1 C A 11: 3,998,227 H145N probably benign Het
Gm13088 T C 4: 143,655,560 I189V probably damaging Het
Helz C T 11: 107,662,030 P1211S probably damaging Het
Herc1 A G 9: 66,394,756 I667V probably benign Het
Herc2 T A 7: 56,103,718 probably null Het
Hivep1 C T 13: 42,154,911 T209I probably damaging Het
Hsph1 A G 5: 149,619,020 Y678H probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ighv1-23 T C 12: 114,764,475 D109G probably damaging Het
Itgb3 T C 11: 104,643,577 V420A possibly damaging Het
Kcnk13 C A 12: 100,061,726 N353K probably damaging Het
Kif21a A G 15: 90,993,796 F270L probably benign Het
Kit T A 5: 75,639,000 V464D probably benign Het
Klhl36 G A 8: 119,870,175 W205* probably null Het
Krt17 A G 11: 100,258,465 Y260H probably damaging Het
Lats1 C T 10: 7,712,942 Q1108* probably null Het
Lrch1 G A 14: 74,757,037 T709I possibly damaging Het
Lrrc58 C A 16: 37,868,691 Q66K probably benign Het
Mei1 G A 15: 82,115,481 A664T Het
Mtmr6 C T 14: 60,300,304 T546M probably benign Het
Ncoa3 T A 2: 166,068,529 F1288L probably damaging Het
Nwd1 G T 8: 72,707,830 V1352L probably benign Het
Olfr1283 T A 2: 111,369,362 H243Q probably damaging Het
Olfr199 A T 16: 59,216,398 C72S probably benign Het
Ovol3 C T 7: 30,235,221 probably null Het
Palb2 C A 7: 122,117,331 V843L probably damaging Het
Pds5a T A 5: 65,652,535 probably null Het
Per1 A G 11: 69,104,735 S714G possibly damaging Het
Plch2 G A 4: 155,000,460 R442C probably damaging Het
Pon2 A T 6: 5,289,080 S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 N834Y probably damaging Het
Rbm46 C T 3: 82,842,488 W483* probably null Het
Rnd1 A T 15: 98,673,901 V88E probably damaging Het
Sbno2 T A 10: 80,069,575 T142S unknown Het
Scn9a C T 2: 66,547,187 V384M possibly damaging Het
Sertad4 T A 1: 192,846,710 H266L possibly damaging Het
Setd5 T A 6: 113,115,082 M288K possibly damaging Het
Sfxn4 T A 19: 60,857,361 N66Y probably damaging Het
Skint6 T A 4: 113,238,228 N78I probably damaging Het
Sltm G T 9: 70,573,466 G200V unknown Het
Smg1 A G 7: 118,195,893 I477T unknown Het
Supv3l1 C T 10: 62,430,470 probably null Het
Syne2 A G 12: 76,015,563 R4220G probably benign Het
Tbr1 A T 2: 61,804,817 H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Tmem231 G T 8: 111,918,408 S155R probably damaging Het
Trem3 A G 17: 48,258,470 *184W probably null Het
Trim33 T A 3: 103,346,640 probably benign Het
Tsen2 G A 6: 115,559,982 W233* probably null Het
Ttc21a T A 9: 119,945,539 N286K probably damaging Het
Tulp4 A T 17: 6,198,708 M194L probably benign Het
Ube3b C A 5: 114,415,284 R906S possibly damaging Het
Ube3b A C 5: 114,418,626 D1006A probably damaging Het
Vipas39 A T 12: 87,241,931 probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Zan T G 5: 137,425,562 I2692L unknown Het
Zfp142 C A 1: 74,585,520 E48D probably benign Het
Zfp598 T C 17: 24,677,530 Y194H probably damaging Het
Zfp85 T C 13: 67,748,945 N336S probably benign Het
Zfyve27 A T 19: 42,189,520 probably null Het
Zp3 T C 5: 135,982,705 S126P probably damaging Het
Other mutations in Asxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Asxl2 APN 12 3474560 missense probably damaging 1.00
IGL01301:Asxl2 APN 12 3501425 missense probably damaging 1.00
IGL01325:Asxl2 APN 12 3427172 missense probably damaging 0.98
IGL01689:Asxl2 APN 12 3496425 missense probably benign 0.28
IGL01871:Asxl2 APN 12 3502112 missense probably benign 0.38
IGL02164:Asxl2 APN 12 3502079 missense probably benign 0.00
IGL02609:Asxl2 APN 12 3500018 missense probably damaging 1.00
IGL03191:Asxl2 APN 12 3500094 missense probably damaging 1.00
ANU18:Asxl2 UTSW 12 3501425 missense probably damaging 1.00
R0092:Asxl2 UTSW 12 3496313 missense probably benign 0.00
R0118:Asxl2 UTSW 12 3496923 missense probably damaging 1.00
R0277:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0323:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0584:Asxl2 UTSW 12 3496632 missense probably damaging 0.96
R0885:Asxl2 UTSW 12 3501458 missense probably damaging 1.00
R1344:Asxl2 UTSW 12 3493790 missense probably damaging 1.00
R1456:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R1829:Asxl2 UTSW 12 3457125 missense probably damaging 1.00
R1909:Asxl2 UTSW 12 3474577 missense probably damaging 1.00
R1990:Asxl2 UTSW 12 3484558 nonsense probably null
R2074:Asxl2 UTSW 12 3493779 missense probably damaging 1.00
R2883:Asxl2 UTSW 12 3501830 missense probably benign 0.03
R2912:Asxl2 UTSW 12 3474517 missense probably benign 0.06
R4446:Asxl2 UTSW 12 3501774 missense possibly damaging 0.54
R4662:Asxl2 UTSW 12 3427193 missense probably damaging 0.99
R4726:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R5034:Asxl2 UTSW 12 3502193 missense probably damaging 0.98
R5287:Asxl2 UTSW 12 3496893 missense probably benign 0.02
R5377:Asxl2 UTSW 12 3474618 splice site probably null
R5611:Asxl2 UTSW 12 3484598 missense probably damaging 1.00
R5708:Asxl2 UTSW 12 3500603 missense possibly damaging 0.82
R5945:Asxl2 UTSW 12 3500439 missense possibly damaging 0.82
R6154:Asxl2 UTSW 12 3496593 missense possibly damaging 0.60
R6288:Asxl2 UTSW 12 3476040 missense possibly damaging 0.91
R6405:Asxl2 UTSW 12 3493758 missense probably damaging 0.99
R6938:Asxl2 UTSW 12 3476149 missense probably damaging 0.98
R7146:Asxl2 UTSW 12 3457066 missense probably damaging 1.00
R7354:Asxl2 UTSW 12 3455637 intron probably benign
R7396:Asxl2 UTSW 12 3442529 missense probably damaging 0.99
R8063:Asxl2 UTSW 12 3500768 missense probably benign 0.01
Z1177:Asxl2 UTSW 12 3474589 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAAGCTGCTTGTACAGTAAGAACC -3'
(R):5'- AAGTGACCTCCCTTGCCTTG -3'

Sequencing Primer
(F):5'- CTTGTACAGTAAGAACCCAATATGGC -3'
(R):5'- CTTGCCTTGCGACGGGTG -3'
Posted On2019-10-07