Incidental Mutation 'R7438:Kif21a'
ID 576777
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Name kinesin family member 21A
Synonyms N-5 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7438 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 90933276-91049948 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90993796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 270 (F270L)
Ref Sequence ENSEMBL: ENSMUSP00000104911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288]
AlphaFold Q9QXL2
Predicted Effect probably damaging
Transcript: ENSMUST00000067205
AA Change: F270L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: F270L

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088614
AA Change: F270L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: F270L

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100304
AA Change: F270L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: F270L

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109287
AA Change: F270L

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: F270L

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109288
AA Change: F270L

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: F270L

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,616,446 S425G probably benign Het
Adam29 A G 8: 55,871,574 I615T probably damaging Het
Arap2 A T 5: 62,749,475 I67N probably damaging Het
Asxl2 C T 12: 3,427,108 probably benign Het
Atp13a4 C T 16: 29,441,196 G607D Het
Atp2c2 G A 8: 119,748,197 V514M probably damaging Het
Baiap3 A G 17: 25,249,108 C311R possibly damaging Het
Becn1 A C 11: 101,294,226 S137R probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
C8a T C 4: 104,861,429 K110E probably damaging Het
Camta2 A G 11: 70,683,888 probably null Het
Capn8 T A 1: 182,598,675 Y192N probably damaging Het
Ccdc170 C T 10: 4,558,512 Q579* probably null Het
Cenpa G T 5: 30,666,948 probably benign Het
Cltc A G 11: 86,725,228 V404A probably benign Het
Cyp3a11 A T 5: 145,865,900 L261Q probably benign Het
Daw1 T A 1: 83,192,715 S249R probably benign Het
Dchs1 T A 7: 105,754,948 I2796F probably benign Het
Dis3l2 T C 1: 86,745,500 probably null Het
Dnah5 A T 15: 28,346,952 D2527V probably damaging Het
Dsg4 G A 18: 20,466,628 R767Q probably damaging Het
Edaradd A G 13: 12,478,457 I118T probably damaging Het
Fam60a A G 6: 148,933,102 Y10H probably benign Het
Fam83h A G 15: 76,004,426 F354S possibly damaging Het
Fat3 A G 9: 15,988,482 V3085A probably benign Het
Fer A G 17: 64,133,521 D711G possibly damaging Het
G6pc G T 11: 101,376,677 V318F probably benign Het
Gal3st1 C A 11: 3,998,227 H145N probably benign Het
Gm13088 T C 4: 143,655,560 I189V probably damaging Het
Helz C T 11: 107,662,030 P1211S probably damaging Het
Herc1 A G 9: 66,394,756 I667V probably benign Het
Herc2 T A 7: 56,103,718 probably null Het
Hivep1 C T 13: 42,154,911 T209I probably damaging Het
Hsph1 A G 5: 149,619,020 Y678H probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ighv1-23 T C 12: 114,764,475 D109G probably damaging Het
Itgb3 T C 11: 104,643,577 V420A possibly damaging Het
Kcnk13 C A 12: 100,061,726 N353K probably damaging Het
Kit T A 5: 75,639,000 V464D probably benign Het
Klhl36 G A 8: 119,870,175 W205* probably null Het
Krt17 A G 11: 100,258,465 Y260H probably damaging Het
Lats1 C T 10: 7,712,942 Q1108* probably null Het
Lrch1 G A 14: 74,757,037 T709I possibly damaging Het
Lrrc58 C A 16: 37,868,691 Q66K probably benign Het
Mei1 G A 15: 82,115,481 A664T Het
Mtmr6 C T 14: 60,300,304 T546M probably benign Het
Ncoa3 T A 2: 166,068,529 F1288L probably damaging Het
Nwd1 G T 8: 72,707,830 V1352L probably benign Het
Olfr1283 T A 2: 111,369,362 H243Q probably damaging Het
Olfr199 A T 16: 59,216,398 C72S probably benign Het
Ovol3 C T 7: 30,235,221 probably null Het
Palb2 C A 7: 122,117,331 V843L probably damaging Het
Pds5a T A 5: 65,652,535 probably null Het
Per1 A G 11: 69,104,735 S714G possibly damaging Het
Plch2 G A 4: 155,000,460 R442C probably damaging Het
Pon2 A T 6: 5,289,080 S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 N834Y probably damaging Het
Rbm46 C T 3: 82,842,488 W483* probably null Het
Rnd1 A T 15: 98,673,901 V88E probably damaging Het
Sbno2 T A 10: 80,069,575 T142S unknown Het
Scn9a C T 2: 66,547,187 V384M possibly damaging Het
Sertad4 T A 1: 192,846,710 H266L possibly damaging Het
Setd5 T A 6: 113,115,082 M288K possibly damaging Het
Sfxn4 T A 19: 60,857,361 N66Y probably damaging Het
Skint6 T A 4: 113,238,228 N78I probably damaging Het
Sltm G T 9: 70,573,466 G200V unknown Het
Smg1 A G 7: 118,195,893 I477T unknown Het
Supv3l1 C T 10: 62,430,470 probably null Het
Syne2 A G 12: 76,015,563 R4220G probably benign Het
Tbr1 A T 2: 61,804,817 H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Tmem231 G T 8: 111,918,408 S155R probably damaging Het
Trem3 A G 17: 48,258,470 *184W probably null Het
Trim33 T A 3: 103,346,640 probably benign Het
Tsen2 G A 6: 115,559,982 W233* probably null Het
Ttc21a T A 9: 119,945,539 N286K probably damaging Het
Tulp4 A T 17: 6,198,708 M194L probably benign Het
Ube3b C A 5: 114,415,284 R906S possibly damaging Het
Ube3b A C 5: 114,418,626 D1006A probably damaging Het
Vipas39 A T 12: 87,241,931 probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Zan T G 5: 137,425,562 I2692L unknown Het
Zfp142 C A 1: 74,585,520 E48D probably benign Het
Zfp598 T C 17: 24,677,530 Y194H probably damaging Het
Zfp85 T C 13: 67,748,945 N336S probably benign Het
Zfyve27 A T 19: 42,189,520 probably null Het
Zp3 T C 5: 135,982,705 S126P probably damaging Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0420:Kif21a UTSW 15 90968054 unclassified probably benign
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1625:Kif21a UTSW 15 90942175 missense probably damaging 1.00
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1648:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1699:Kif21a UTSW 15 90959743 missense probably damaging 0.99
R1703:Kif21a UTSW 15 90949047 splice site probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1961:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90934464 missense probably benign
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 splice site probably null
R4612:Kif21a UTSW 15 90968223 splice site probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
R7058:Kif21a UTSW 15 90948903 splice site probably null
R7147:Kif21a UTSW 15 90980883 missense probably benign 0.13
R7290:Kif21a UTSW 15 90967229 nonsense probably null
R7593:Kif21a UTSW 15 90943861 missense probably benign 0.03
R7661:Kif21a UTSW 15 90980919 missense possibly damaging 0.89
R7891:Kif21a UTSW 15 90956314 missense probably damaging 1.00
R8137:Kif21a UTSW 15 90968442 missense probably benign
R8182:Kif21a UTSW 15 90935761 missense possibly damaging 0.77
R8303:Kif21a UTSW 15 90971196 missense probably damaging 0.99
R8388:Kif21a UTSW 15 90959124 missense possibly damaging 0.60
R8867:Kif21a UTSW 15 90968179 missense probably damaging 0.96
R8921:Kif21a UTSW 15 90971727 missense probably benign 0.04
R8984:Kif21a UTSW 15 90956356 missense probably benign 0.00
R9024:Kif21a UTSW 15 90937196 nonsense probably null
R9254:Kif21a UTSW 15 90969827 missense probably damaging 0.99
R9366:Kif21a UTSW 15 90959748 missense probably damaging 0.99
R9379:Kif21a UTSW 15 90969827 missense probably damaging 0.99
R9393:Kif21a UTSW 15 90969778 missense probably benign 0.00
R9518:Kif21a UTSW 15 90956473 missense probably damaging 1.00
R9712:Kif21a UTSW 15 90985325 missense probably damaging 0.98
R9712:Kif21a UTSW 15 90995512 missense probably benign 0.13
R9721:Kif21a UTSW 15 90971127 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACAGTGAGGATTTCCATGAG -3'
(R):5'- GTTTCTCCAGCTGTGCAAGG -3'

Sequencing Primer
(F):5'- AGGCGAGCCTGCACTACTTAATG -3'
(R):5'- CTGTGCAAGGGGGCAGATG -3'
Posted On 2019-10-07